ABSTRAKToxopiasnia Gondii adalah suatu protozoa yang dapat menginfeksi manusia. Infeksi T.gondii pada orang dewasa biasanva tanpa gejala klinis, sedangkan pada orang yang imunokompromais dapat berakibat fatal.
Diagnosis toksoplasinosis biasanya dilakukan dengan uji serologi yaitu enzyrnelinked inunurnosorbent assay (ELISA) untuk mendeteksi IgG dan IgM Namun pemeriksaan serologi ini tidak memberikan hasil yang memuaskan, sedangkan pengobatan dini perlu dilakukan. Polymerase chain reaction (PCR) merupakan salah satu teknik yang dapat mengatasi masalah tersebut.
Penetitian bertujuan untuk mengetahui apakah teknik PCR dapat mendeteksi DNA T.gondii dengan optimasi tekniknya. Teknik ini dilakukan terhadap DNA takizoit T.gondii dengan menggunakan primer 5'GGAACTGCATCCGTTCATGAG3' dan 5'TCITTAAAGCGTTCGTGGTC3'. konsentrasi MgC12 1,5 mM dan 2,0 mM, konsentrasi enzim taq polimerase 0,7 U dan 1,75 U, konsentrasi cetakan DNA 50; 5; 1; 0,5; 0,1; 0,05; 0,01; 0,005 dan 0,001 ng dan jumlah siklus : 35 dan 55 siklus.
Hasil menunjukkan bahwa konsentrasi MgC12 1,5 mM, konsentrasi taq polimerase 1,75 U dengan jumlah siklus 55 inemberikan hasil produk PCR berupa pita berukuran 193 hp dengan konsentrasi cetakan DNA sampai 0,00 ng.
Dapat disimpulkan bahwa teknik PCR merupakan teknik yang sensitif yaitu dapat mendeteksi 1 pg DNA gondii.
ABSTRACT
Polymerase Chain Reaction to Detect Tachyzoites of Toxoplasma gondiiToxoplasma gondii is a protozoan which can infect human. T. gondii infection is oiler asymptomatic in healthy individuals, however in imrnunocompromised individuals it can be fatal.Diagnosis of toxoplasmosis is usually performed by serology using enzyme-linked immunosorbent assay (ELISA) to detect IgG and IgM. However, serology tests do not give an adequate result, while early treatment is necessarily performed. Polymerase chain reaction is a technique which can solve the problem.The aim of this study is to know whether the PCR technique can detect ".gondii DNA. The technique was performed on DNA of T .gondii tachyzoites using Bl gene primers : 5' GGAACTGCATCCGITCATGAG3' and 5'TCTTTAAAGCGTTCGTG G T C with MgCI2 concentrations of 1.5 mM and 2.0 mM, taq polymerase concentrations of 0.7 U and 1.75U, with DNA template concentations of 50, 5, 1, 0.5. U.1, 0.05, 0.01, 0.005 and 0.001 n.. Cycles used in this study were 35 and 55.The results showed that concentrations of 1.5 mM MgC12 and 1.75 U taq polymerase using 55 cycles gave good PCR results. With electrophoresis, the PCR product was a band of 193 bp.It was concluded that PCR is a sensitive technique which can detect 1 pg of T .gondii DNA.