Hasil Pencarian  ::  Simpan CSV :: Kembali

"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

---

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."

"Demam berdarah merupakan salah satu masalah kesehatan di dunia. Infeksi virus dengue yang berulang dengan serotipe yang berbeda dapat memacu terjadinya demam berdarah bahkan kematian. Dengue serotipe 4 dilaporkan dapat menyebabkan infeksi sekunder yang lebih parah dibandingkan dengue serotipe lainnya. Sampai saat ini pengobatan demam berdarah belum ditemukan, maka itu pencegahan jauh lebih penting. Para peneliti telah merekomendasikan vaksin aman berbasis nonstructural protein 1 (NS1) karena sifat imunogeniknya. Mereka telah mengidentifikasi empat epitope di NS1 yang diduga bereaksi kuat dengan epitope B cells, yaitu LD2, 24A, LX1, 24C. Tujuan dari riset ini adalah untuk menganalisa dan membandingkan strain DENV-4 yang diisolasi di Jakarta 2010 dengan 34 strain DENV-4 lainnya yang didapat dari GenBank menggunakan UGENE software sebagai basis dari pengembangan vaksin. Penelitian ini menggunakan data sekunder berupa urutan nukelotida virus dengue serotipe 4 strain IDSS44/10 yang diamplifikasi dan diurutkan di Departemen Mikrobiologi, FKUI. Dari hasil penelitian ini dapat disimpulkan bahwa gen NS1 dari DENV-4 strain IDSS44/10 dapat digunakan sebagai kandidat vaksin dengue di masa mendatang. Hasil menunjukkan bahwa epitope 24C menunjukkan motif yang homolog di setiap sekuens asam amino pada NS1 DENV-4. Hampir seluruh DENV-4 strain yang diisolasi termasuk IDSS44/2010 memiliki urutan asam amino yang sama pada epitop LD2, 24A, LX1, 24C.

---

Dengue hemorrhagic fever has become a worldwide issue. Heterologous infection by different serotypes may lead to this advanced stage of dengue infection and even death. Dengue virus serotype 4 has been reported to cause more severe secondary infection compared to other serotypes. To date, there is no specific treatment for this disease therefore prevention is much more important.

Researchers have proposed a safe vaccine strategy that is based on nonstructural protein 1 (NS1) as it is strongly immunogenic. They identified four epitopes on NS1 that reacted strongly to B cell epitopes which are LD2, 24A, LX1, and 24C. The goal of this research is to identify and compare these NS1 epitopes among DENV-4isolated in Indonesia 2010 with other DENV-4 strains using UGENE softwareas a base of vaccine development. This study used a nucleotide sequence data of DENV-4 strain IDSS44/10 that was amplified and sequenced in Microbiology Department, FKUI.

The results show that NS1 gene DENV-4, IDSS44/2010 strain could be used as a dengue vaccine candidate in the future.The results show that 24C epitope was highly conserved among 35 DENV-4 NS1 sequences. Most of the DENV-4 including IDSS44/10 Indonesian strain have similar amino acids sequences on the epitopes (LD2, 24A, LX1, and 24C)."

"Demam Berdarah Dengue (DBD) adalah infeksi yang disebabkan oleh virus dengue (DENV) yang tersebar luas di wilayah tropis dan subtropis di dunia. DENV merupakan virus RNA rantai tunggal yang mengkode tiga protein struktural, tujuh protein non-struktural, dan dua daerah yang tidak ditranslasikan (UTR). Protein non-struktural 1 (NS1) DENV diketahui memiliki peran yang sangat penting dalam patogenesis infeksi DENV dan sebagai pengembangan vaksin dengue yang menjanjikan. Saat ini, pengembangan vaksin baru dengan DNA yang diimunisasikan memberikan perspektif baru karena aman, stabil, dan imunogenik. Pada penelitian sebelumnya, kami telah berhasil mengonstruksi vaksin rekombinan DNA yang mengkode protein NSI dari DENV-2 (pUNS1) dan diekspresikan secara in-vitro. Oleh karena itu, pada penelitian ini dilakukan analisis lebih lanjut untuk melihat kemampuan pUNS1 dalam menginduksi respons imun humoral dengan imunisasi in-vivo. Sebanyak 16 mencit Balb/c yang berumur 4 minggu diimunisasi sebanyak 3 kali dengan 100 μg pUNS1 atau pUMVC4.a dalam interval waktu 1 minggu. Pengambilan sampel darah mencit dilakukan sebelum imunisasi dan dilakukan terminasi 1 minggu setelah imunisasi terakhir. Titer antibodi dari serum masing-masing mencit diukur dengan ELISA in-house. Titer IgG total, antibodi subkelas IgG2a dan IgG2b dari kelompok mencit yang diimunisasi dengan rekombinan pUNS1 menunjukkan perbedaan yang signifikan antara serum pre-imunisasi dengan terminasi. Hal ini membuktikan kemampuan pUNS1 dalam menginduksi respons imun humoral terhadap NS1 DENV-2 secara in-vivo

---

Dengue Hemorrhagic Fever (DHF) is an infectious disease caused by the dengue virus (DENV) which spread widely in tropical and subtropical regions of the world. DENV is a single-positive strand RNA virus which encodes three structural proteins, seven non-structural proteins, and two untranslated regions (UTR). The non-structural protein-1 (NS1) of DENV is known to have important role in dengue pathogenesis also promising to be developed as dengue vaccine. Lately, novel vaccine approach by DNA immunization have given new perspective for a safe, stable, and immunogenic vaccine platform. Previously, we have successfully construct DNA vaccine encoding NS1 protein of DENV2 (pUNS1) which express recombinant NS1 protein in-vitro. Thus, in this current study the ability of pUNS1 to induce humoral immune response will be further analyzed by in-vivo immunization. Sixteen Balb/c mice aged of 4 weeks were immunized 3 times with 100 μg of pUNS1 or pUMVC4.a on 1 week time interval. Blood sampling was carried out just before immunization and termination was done 1 week after last immunization. Titer from individual mice sera against DENV-2 were measure with in-house ELISA. Total IgG titers, subclass IgG2a, and IgG2b antibodies from mice group immunized with recombinant pUNS1 showed a significant difference between pre-immunization and terminated serum. This is proven the ability of pUNS1 to induce humoral immune response against NS1 DENV-2 in-vivo."

"Infeksi virus Dengue (DENV) masih menjadi masalah kesehatan dunia termasuk Indonesia, mengamcam lebih dari 150 ribu jiwa setiap tahunnya. Meski berbagai usaha preventif konvensional telah dilakukan, angka keparahan tetap tidak jauh berkurang. Karena itu, vaksin dikembangkan sebagai usaha preventif yang efektif sekaligus efisien. Sayangnya, jumlah studi filogenetik yang mendukung pengembangan vaksin saat ini masih terbatas. Untuk itu, penelitian ini dilakukan dengan menganalisis sekuens nukleotida dan asam amino protein Non Struktural-1 (NS-1) pada bagian epitope. Analisis dilakukan dari data yang dikumpulkan melalui GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia, 29 sekuens diolah menggunakan program Genetyx 5.1. Hasil analisis menunjukkan persebaran filogenetik berdasarkan nukleotida NS-1 strain Indonesia yang berada pada Genotipe I dan IV dan tidak berbeda dengan filogenetik berdasarkan gen envelope. Sedangkan, hasil homologi asam amino menunjukkan substitusi terjadi pada beberapa situs epitope NS-1 yang sebelumnya dianggap lestari. Hasil ini menunjukkan bahwa, analisis NS-1 dapat digunakan sebagai dasar pengembangan vaksin dengue.

---

Until to date, dengue virus (DENV) infection is still a major global health problem including Indonesia, putting over 150 thousands people at risk every year. Despite various conventional preventive efforts conducted, number of people with severe dengue is not reduce significantly. Vaccine is than developed in a hope to make a more effective and efficient way of dengue prevention. But, only a limited number of phylogenetic studies have been conducted to support the vaccine development. This phylogenetic studies of dengue virus (DENV) is conducted in order to support the basis for development of protective dengue vaccine. This study analyze nucleotides and amino acids sequence of Non Structural-1 (NS-1) protein and emphasizing at epitope sites. By using Genetyx 5.1, 29 samples that have been collected from Laboratory of Microbiology Faculty of Medicine Universitas Indonesia and GenBank were analized. Phylogenetic tree analysis using NS-1 nucleotides showing that isolates from Indonesia is potitioned within genotipe I and IV, insignifically different with phylogenetic tree analysis using envelope nucleotides. While, amino acid homology analysis showing subtitution between NS1 epitope sites that considered being conserved at the previous studies. This results shows that, NS-1 analysis can be used as a basis of vaccine development."

"ABSTRAKPenelitian terkait karakteristik genetik sekuens virus dengue (DENV) diperlukan dalam menilai kekerabatan antara strain DENV yang tersebar di seluruh dunia. Tujuan dalam penelitian ini adalah membandingkan karakteristik genotype dan sekuens data DENV serotipe 2 (DENV-2) nukleotida envelope dibandingkan dengan sekuens data DENV-2 nukleotida Non-Struktural 1 (NS1). Data didapatkan dari Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia untuk strain data yang berasal dari Indonesia dan GenBank untuk strain data yang berasal dari seluruh dunia sebagai data pembanding dengan jumlah sebanyak 42 data, yang kemudian dianalisis menggunakan Genetyx 5.1. Hasil penelitian didapatkan bahwa sekuens data NS1 strain DENV-2 yang berasal dari Indonesia termasuk ke dalam kelompok genotype Cosmopolitan, serupa dengan hasil analisis data dengan sekuens data envelope strain DENV-2. Sementara pada analisis epitope LX1 yang merupakan epitope khas dari NS1, terdapat berbagai peubahan komponen asam amino pada epitope tersebut dibandingkan dengan sekuens data strain Indonesia yang tergabung ke dalam kelompok genotype Cosmopolitan. Kesimpulan dari penelitian ini adalah bahwa filogenetik dengan menggunakan NS1 sebagai bahan analisis dapat digunakan untuk menentukan genotipe. Sehingga gen NS1 pada DENV-2 strain Indonesia masih dapat dipertimbangkan sebagai salah satu dasar metode pengembangan vaksin.

---

ABSTRACTStudies about genetic characteristic between dengue virus serotype 2 (DENV-2) sequence data is needed to determine its relationship between DENV strain over the world. The main purpose of this study is to compare between characteristic of sequence data DENV-2 envelope nucleotide and sequence data DENV-2 Non- Structural 1 (NS1) nucleotide, and analyze between amino acid homology in this study and related previous studies. 42 data used for this study are obtained from Laboratory of Microbiology Faculty of Medicine University of Indonesia for data from Indonesia and form GenBank for data from other countries as a comparison, which is analyzed with software Genetyx 5.1. NS1 sequence data from DENV-2 strain from Indonesia is classified in Cosmpolitan genotype group, which are similar than data analysis from envelope sequence data from same data. Meanwhile in analysis of LX1 epitope, which is considered as typical epitope from NS1, there are any differences in amino acid component at it compared than strain Indonesia data sequences which are included in Cosmopolitan genotype group. As a conclusion, phylogenetic analysis of NS1 nucleotide is useful for determining the genotypes, which means NS1 DENV-2 gene strain Indonesia can be useful as the basis for vaccine development"

"[ABSTRAKDemam berdarah dengue (DBD) merupakan penyakit yang disebabkan karenainfeksi virus dengue (DENV), yang banyak ditemukan di Indonesia. Belum adaterapi yang spesifik dalam pengobatan DBD. Upaya pengembangan vaksindengue yang efektif sangat diperlukan. Pada penelitian ini dilakukan analisaimunogenisitas kandidat vaksin DNA prM-E dengue serotipe 2 (pUMD2.kl.20)dengan menganalisis sel T CD4, sel T CD8, IFN-γ dan TNF-α. pada sel U937 danPBMC secara in vitro, bertujuan untuk mengetahui respon imun ketika vaksindiinjeksikan ke dalam tubuh manusia. Dasar penelitian ini adalah sel U937ditransfeksi dengan pUMD2.kl.20 menggunakan lipofectamin. Sel U937 akanberperan sebagai APCs yang akan mengekspresikan protein prM-E DENV-2 danmempresentasikan protein tersebut melalui molekul MHC class I dan MHC classII kepada Peripheral Blood Mononuclear Cell (PBMC) manusia. Tahapan kerjayang dilakukan dalam penelitian ini terdiri dari: (a) kultur galur sel U937, (b)transfeksi sel U937 dengan pUMD2.kl.20, (c) transfeksi sel U937 dengan plasmids(pUMVC), (d) infeksi sel U937 dengan DENV-2 strain DS.18/09, (e) pewarnaandan pengamatan hasil pewarnaan menggunakan alat semi flowcytometri (TALI).pUMD2.kl.20 mengaktivasi sel T CD4 dan sel T CD8 untuk berploriferasi. Hasilpenelitian ini menunjukkan bahwa konsentrasi sel T CD8 lebih tinggi darikonsentrasi sel T CD4 dan konsentrasi sel positif yang mensekresikan IFNγ lebihtinggi dari konsentrasi sel positif yang mensekresikan TNFα. Kondisi optimal dariaktivasi sel T CD4 oleh pUMD2.kl.20 adalah 24 jam setelah penambahan PBMCsetelah transfeksi (8,53x10⁴sel/ml), untuk sel T CD8 adalah 24 jam setelahpenambahan PBMC setelah transfeksi (49,4x10⁴ sel/ml). Kondisi optimal dariaktivasi sel+ yang mensekresikan IFNγ oleh pUMD2.kl.20 adalah 24 jam setelahpenambahan PBMC 48 jam setelah transfeksi (9,86x10⁴ sel/ml), dan untuk sel+yang mensekresikan TNFα adalah 2 jam setelah penambahan PBMC 48 jamsetelah transfeksi (2,1x10⁴ sel/ml). Dari penelitian ini dapat disimpulkan bahwapUMD2.kl.20 bersifat imunogenik.

---

ABSTRACTDengue hemorrhagic fever (DHF) is a disease caused by infection with denguevirus (DENV), which is found in Indonesia. There is no specific therapy in thetreatment of DHF. An effort to develop an effective dengue vaccine is needed. Inthis research, analysis of the immunogenicity of the DNA vaccine candidate prMEdengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine theimmune response when the vaccine is injected into the human body. This researchapproach is based on transfection of U937 cells with pUMD2.kl.20 usinglipofectamin. U937 cells acts as APCs which will express the protein prM-EDENV-2 and presenting these proteins through the MHC class I and MHC class IImolecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.Stages of the work in this study consisted of: (a) culture cell line U937, (b)transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells withplasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,(e) staining and observation results of staining using a semi-flow cytometri(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 Tcells concentration higher than the concentration of CD4 T cells and the secretionof INFγ-positive cells concentration higher than the concentration of the secretionof TNFα-positive cells. Optimal condition of CD4 T cells activation bypUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴cells/ml), for CD8 T cells was 24 hours after the addition of PBMC aftertransfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positivecells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-positive cells were activated by pUMD2.kl.20 is 2 hours after the addition ofPBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can beconcluded that the pUMD2.kl.20 immunogenic, Dengue hemorrhagic fever (DHF) is a disease caused by infection with denguevirus (DENV), which is found in Indonesia. There is no specific therapy in thetreatment of DHF. An effort to develop an effective dengue vaccine is needed. Inthis research, analysis of the immunogenicity of the DNA vaccine candidate prMEdengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine theimmune response when the vaccine is injected into the human body. This researchapproach is based on transfection of U937 cells with pUMD2.kl.20 usinglipofectamin. U937 cells acts as APCs which will express the protein prM-EDENV-2 and presenting these proteins through the MHC class I and MHC class IImolecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.Stages of the work in this study consisted of: (a) culture cell line U937, (b)transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells withplasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,(e) staining and observation results of staining using a semi-flow cytometri(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 Tcells concentration higher than the concentration of CD4 T cells and the secretionof INFγ-positive cells concentration higher than the concentration of the secretionof TNFα-positive cells. Optimal condition of CD4 T cells activation bypUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴cells/ml), for CD8 T cells was 24 hours after the addition of PBMC aftertransfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positivecells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-positive cells were activated by pUMD2.kl.20 is 2 hours after the addition ofPBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can beconcluded that the pUMD2.kl.20 immunogenic]"

"Kondisi iklim tropis Indonesia menyebabkan Indonesia menjadi salah satu kontributor kasus infeksi DENV terbanyak. Saat ini diperlukan pengembangan vaksin yang harus didasari oleh studi filognetik virus, khususnya DENV serotipe 2 (DENV-2) yang merupakan DENV serotipe paling dominan di Indonesia. Penelitian ini bertujuan untuk menganalisa perbandingan sekuens dan filogenetik nukleotida Envelope lengkap dengan Domain III. Sejumlah 42 data diambil dari GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia berupa sekuens whole genome DENV-2. Sekuens tersebut diolah dengan software Genetyx 5.1. Hasil penelitian menunjukan strain Indonesia merupakan genotipe Cosmopolitan. Sedangkan analisis filogenetik Envelope lengkap dan Domain III menunjukkan perbedaan. Genotipe Asia II menjadi bagian genotipe American pada analisis filogenetik Domain III. Dari hasil penelitian dapat disimpulkan bahwa filogenetik Domain III saja tidak dapat digunakan untuk penentuan genotipe.

---

Indonesia's tropical climate conditions caused Indonesia become one of the largest contributors of DENV infection. Currently, we required the development of a vaccine that must be based on studies phylogenetic virus, in particular 2 DENV serotypes (DENV-2) which is the most predominant serotype DENV in Indonesia. This study aims to analyze the nucleotide sequence comparisons and phylogenetic complete Envelope with Domain III. A total of 42 data retrieved from GenBank and the Laboratory of Microbiology, Faculty of Medicine, University of Indonesia in the form of whole genome sequences of DENV-2. The sequence processed with GENETYX 5.1 software. The results showed Indonesia strain is part of Cosmopolitan genotype. Whereas the Envelope epitope analysis and the Domain III epitope analysis show significant differences. Genotype Asian II became part of the American genotype on phylogenetic analysis of Domain III. From the results of this study concluded that the phylogenetic domain III alone cannot be used for the determination genotpe."

"ABSTRAKInfeksi yang disebabkan oleh virus dengue telah banyak dilaporkan di negara tropis dan subtropis. Virus dengue terdiri dari 4 serotipe yaitu dengue 1-4. Hingga saat ini belum tersedia vaksin yang berlisensi untuk mencegah terjadinya infeksi dengue. Pada penelitian ini dikonstruksi vaksin DNA yang mengkode gen prM-E dan prM-E-NS1del virus dengue 2 strain Indonesia yang akan dijadikan sebagai kandidat vaksin dengue. Hasil penelitian berhasil mendapatkan 9 plasmid rekombinan pUMDE2 yang membawa gen sisipan prM-E dan telah dikonfirmasi dengan melakukan PCR koloni dan restriksi plasmid. Dari hasil sekuensing plasmid pUMDE2 koloni no. 11 ditemukan 19 mutasi asam amino pada gen prM-E, sepuluh mutasi pada gen prM dan sembilan mutasi pada gen E. Mutasi protein prM N29D dan N52K serta protein E V164I dan S390N terletak pada daerah epitop pengenalan sel B. Transfeksi plasmid pUMDE2 dilakukan pada sel Chinese Hamster Ovary (CHO)-K1 dan menunjukkan adanya ekspresi protein prM-E rekombinan berdasarkan uji imunostaining dan ELISA. Hasil ELISA menunjukkan bahwa protein ditemukan pada sel yang ditransfeksi. Sedangkan, plasmid rekombinan yang membawa gen prM-E-NS1del tidak berhasil dikonstruksi. Plasmid pUMDE2 dapat dikembangkan menjadi kandidat vaksin DNA.

---

ABSTRACT

Infection by dengue virus were reported in tropical and subtropical area. Dengue virus (DENV) consist of 4 serotype, DENV-1 to DENV-4. There is no licensed vaccine available for dengue infection. In this research, we construct DNA vaccine encode prM-E and prM-E-NS1del genes of dengue virus serotype 2 for vaccine development. Nine recombinant plasmids that encode prM-E genes (pUMDE2), were successfully obtained. Recombinant plasmids were confirmed by PCR colony and restriction enzyme analysis. Colony of pUMDE2 no. 11 was sequenced and total 19 amino acid mutations were founds, 10 mutations in prM and 9 mutations in E protein. prM mutations N29D and N52K, E mutations of V164I and S390N were found in B cell epitopes. Transfection pUMDE2 plasmid was done to Chineese Hamster Ovary (CHO)-K1 and showed that recombinant protein prM-E was successfully expressed by immunostaining assay and ELISA. Results showed that the protein was mainly found in cell fraction. However, recombinant plasmid that encode prM-E-NS1del were failed to be constructed. pUMDE2 could be developed for vaccine candidate."

"Indonesia merupakan negara dengan jumlah kasus dengue terbanyak dan terparah di Asia Tenggara Studi filogenetik virus dengue DENV diperlukan sebagai dasar pengembangan struktur vaksin yang cocok Meskipun demikian data sekuens DENV masih terbatas Penelitian ini bertujuan menganalisis sekuens dan filogenetik keseluruhan gen envelope DENV 1 dibandingkan dengan domain III saja Data didapatkan dari GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia berupa whole genome DENV 1 sebanyak 30 sekuens yang diolah dengan Genetyx 5 1 Hasil analisis nukleotida gen envelope DENV 1 menunjukan strain Indonesia termasuk genotipe I dan IV Sedangkan analisis nukleotida dengan hanya domain III menunjukan adanya perbedaan cluster antar strain namun tetap dalam genotipe yang sama Dengan demikian studi filogenetik penentuan genotipe dapat dilakukan dengan hanya menggunakan domain III saja Analisis homologi asam amino domain III menunjukan epitope utama dilestarikan dan dapat menjadi landasan penting dalam pembuatan vaksin dengue berbasis domain III

---

Phylogenetic study of dengue virus DENV is required as a basis to develop a suitable structure for vaccine development Nonetheless DENV sequence data is limited This study aims to analyze and compare the sequence and phylogenetic of DENV 1 envelope gene with domain III The data is obtained from GenBank and Laboratory of Microbiology Faculty of Medicine Universitas Indonesia Thirty sequences of DENV 1 whole genome were processed using Genetyx 5 1 Analysis using DENV 1 envelope nucleotide showed that strain Indonesia has genotype I and IV Analysis using only the nucleotide of domain III showed the same genotype with difference of clusters between strains Thus phylogenetic studies determining the genotype can be done using domain III alone Homology analysis of amino acid of domain III showed that the main epitope is well reserved This finding can be an important cornerstone in the development of domain III based dengue vaccine."

"Indonesia merupakan negara pertama ditemukannya penyakit demam berdarah, yaitu pada tahun 1968. Hingga pada tahun 2004, beberapa studi menemukan bahwa virus dengue serotipe 3 (DENV-3) merupakan penyebab demam berdarah paling dominan dan menyebabkan gejala yang paling berat. Tujuan dari studi ini adalah untuk mengetahui genotype dari DENV-3 di Jakarta yang berguna untuk diagnosis awal dan pengembangan vaksin. Ditambah lagi, primer yang di rancang di penelitian ini berguna untuk penelitian demam berdarah berikutnya. Riset ini diambil dari 100 pasien demam berdarah rawat inap di RSCM dan pengumpulan setiap data dibantu oleh lembaga Eijkman. Sampel diambil dengan consecutive sampling dan dianalisis menggunakan Genetyx v5.1. Hasil dari penelitian ini menunjukan bahwa mayoritas virus dengue serotipe 3 yang ditemukan di Indonesia termasuk dalam genotipe I yang hampir identik dengan dengue virus serotipe 3 dari Thailand. Selain itu, ditemukan bahwa tingkat pasien demam berdarah pada anak-anak lebih tinggi disbanding pasien dewasa. Namun berdasarkan uji chi-square, ditemukan bahwa kategori jenis kelamin, umur dan daerah Jakarta tidak terdapat hubungan signifikan dengan terjadinya demam berdarah. Para peneliti diharapkan untuk melakukan penelitian lebih lenjut untuk melakukan sequencing lebih banyak lagi dan tidak hanya dilakukan di Jakarta saja tetapi di daerah lain, karena tingkat pasien demam berdarah yang tinggi di Indonesia.

---

Indonesia was the first country where dengue hemorrhagic fever (DHF) was found in 1968. Ever since, the increasing cases were reported every year, and this became a major concern of health problem worldwide. In addition, dengue virus (DENV) serotype 3, which cause the most severe clinical manifestation among other dengue virus strands, was found as the most predominant DENV in Indonesia.

This study aimed to find the genotype of the dengue virus in Jakarta to become the base in the development of vaccine and molecular diagnostic. Moreover, this study designed the primer of DENV for future laboratories research. This study was participated by 100 suspected dengue patients in RSCM and data collection was conducted by Eijkman, the research institute. Samples were taken by consecutive sampling and analysed by Genetyx v5.1.

The results gave information that a majority of virus dengue serotype 3 in Indonesia was consisted of genotype I, which is identical with dengue virus serotype 3 in Thailand. Furthermore, we found that the incidence of pediatric dengue patients is higher than adults. However, in accordance with the chi square test, there is no significant relationship between different patient’s categories (gender, age, region).

It is expected that, DNA sequencing for other DENV-3 should be inspected further in Jakarta and this research should also be done in other areas in Indonesia as this country is one of the countries with high yield of dengue evidence."