Hasil Pencarian  ::  Simpan CSV :: Kembali

"Latar belakang: Karsinoma nasofaring (KNF) merupakan penyakit genetik multifaktorial, bersifat endemik dan mempunyai perbedaan signifikan dalam distribusi geografi s. Selain faktor virus Epstein Barr (EBV), insiden KNF juga dipengaruhi oleh faktor genetik seperti polimorfi sme gen reseptor sel T lokus β (TCR-β). Penelitian ini bertujuan untuk mengetahui hubungan polimorfi sme gen TCR-β dengan suseptibilitas individu untuk berkembang menjadi KNF pada populasi Indonesia. Metode: Penelitian dilakukan dengan teknik PCR-RFLP menggunakan enzim restriksi Bgl II pada gen TCR-β. Analisis PCR-RFLP gen TCR-β digunakan untuk mendeterminasi alotip gen TCR-β pada penderita KNF dan kontrol dan pada kelompok etnis Cina dan pribumi dalam populasi Indonesia. Hasil: Hasil penelitian menunjukkan bahwa distribusi alotip gen TCR-β pada penderita KNF dan kontrol tidak berbeda bermakna (p > 0,05). Frekuensi alel A meningkat pada penderita KNF. Distribusi alotip gen TCR-β antara etnis Cina dan kelompok pribumi tidak memperlihatkan perbedaan bermakna (p> 0,05). Kesimpulan: Distribusi alel gen TCR-β antara kelompok KNF dengan kelompok kontrol tidak menunjukkan perbedaan. Distribusi alel gen TCR-β antara etnis Cina dan pribumi tidak menunjukkan perbedaan. Polimorfi sme gen TCR-β tidak berhubungan dengan KNF dan etnis pada populasi Indonesia.

---

AbstractBackground: Nasopharyngeal carcinoma (NPC) is a multifactorial genetic disease, characteristically endemic and shows considerable differences in its geographical distribution. Besides infection with EBV, genetic factors such as polymorphisms of TCR-β gene contribute to the incidence of NPC. This study investigates the association of TCR-β gene polymorphisms with individual susceptibility to develop NPC in Indonesian ethnic groups. Methods: The study was carried out by the PCR-RFLP method using Bgl II restriction enzyme to digest TCR-β gene. The PCR-RFLP analysis of TCR-β gene was used to determine allotypes of TCR-β gene in NPC patients and control among ethnic Chinese and indigenous groups in the population of Indonesia. Results: The results indicate that the distribution of TCR-β gene allotypes between NPC patients and controls are not signifi cantly different (p > 0.05); however, the frequency of A allele tends to increase in NPC patients. The distribution of TCR-β gene allotypes between Chinese ethnic group was not signifi cantly different from indigenous groups (p > 0.05). Conclusion: The distribution of TCR-β gene allele between NPC group and control groups showed no difference. The distribution of TCR-β gene between ethnic Chinese and indigenous groups showed no difference. Polymorphisms of TCR-β gene are not associated with NPC and ethnic groups in Indonesian population. "

"Demam berdarah dengue (DBD) merupakan penyakit infeksi yang diakibatkan oleh virus dengue. Tiap tahunnya, kematian akibat DBD di Indonesia terus meningkat. Daun kenikir (Cosmos caudatus) merupakan salah satu bahan natural yang digunakan sebagai antiviral terhadap dengue. Hal ini dikarenakan daun kenikir mengandung zat flavonoid aktif yang memiliki efek antiviral Tujuan dari penelitian ini adalah untuk mengetahui perbandingan mekanisme penghambatan ekstrak daun kenikir fraksi n-heksana pada reseptor sel Huh7it-1 dengan penempelan virus dengue secara in vitro. Efek antivirus dilihat menggunakan 2 kali nilai IC50 yaitu 2.994 μg/ml pada sel Huh7it-1. Mekanisme yang dibandingkan ialah pada pemberian reseptor dan saat penempelan. Penentuan presentase penghambatan dihitung melalui perbandingan jumlah focus perlakuan dan kontrol DMSO dikalikan 100%. Viabilitas sel pada penelitian dihitung dengan menggunakan MTT assay dan dibandingkan dengan nilai viabilitas kontrol DMSO. Presentase penghambatan infektivitas virus dengue pada reseptor dan penempelan menggunakan ekstrak daun kenikir fraksi n-heksana bernilai negatif sebesar -23,21% dan -5,37% secara berurutan sehingga menunjukkan peningkatan infektivitas. Pada uji viabilitas sel reseptor ditunjukkan angka 103,9294%. Sedangkan, pada penempelan virus viabilitas sel 96,8284%. Ekstrak daun kenikir berpotensi menjadi antivirus melalui metode penghambatan reseptor meskipun bukan pada penghambatan proses penempelan virus pada sel. Penelitian lebih lanjut perlu dilakukan untuk mencari mekanisme terbaik dalam inhibisi DENV serta mencari tahu molekul spesifik sebagai target protein dari ekstrak daun kenikir fraksi n-heksana."

"ABSTRAKVirus Dengue (DENV) dan virus Chikungunya (CHIKV) merupakan arbovirus yang menyebabkan infeksi di negara tropis dan subtropis. Penularan kedua virus ini diperantarai oleh vektor yang sama yaitu nyamuk Aedes aegypti. Baik infeksi DENV maupun CHIKV, akan memunculkan respon imun spesifik yang disebabkan oleh sekresi sitokin, kemokin, dan faktor pertumbuhan sebagai mediator inflamasi. Respon imun ini menimbulkan gejala klinis yang mirip hingga sulit dibedakan antara infeksi kedua virus ini. Penelitian ini bertujuan untuk menganalisis profil ekspresi sitokin antara infeksi DENV dan CHIKV dengan sistem galur sel A549 dan HepG2. Untuk mencapai tujuan tersebut, metode yang dilakukan yaitu dengan metode Fluorescence-Activated Cell Sorting (FACS) untuk menentukan tingkat infeksi tertinggi pada masing-masing galur sel dan Enzyme Linked Immunosorbent (ELISA) untuk analisis sitokin/kemokin. Hasil FACS menunjukkan tropisme DENV terhadap galur sel A549 dan CHIKV terhadap galur sel HepG2. Dari keempat sitokin dan kemokin yang diuji yakni IL-8, IL-4, IL-13, dan MCP-3, hasil signifikan ditunjukkan ekspresi IL-8 dan MCP-3. Profil ekspresi kemokin IL-8 lebih tinggi pada galur sel A549 dibandingkan HepG2 sedangkan profil ekspresi kemokin MCP-3 lebih tinggi pada galur sel HepG2 dibandingkan A549. Perbandingan profil ekspresi keduanya, lebih tinggi pada galur sel yang terinfeksi DENV (DENV-4) dibandingkan CHIKV. Penelitian ini membuktikan adanya perbedaan ekspresi sitokin/ kemokin pada galur sel A549 dan HepG2 terhadap infeksi DENV dan CHIKV.

---

ABSTRACT

Dengue Virus (DENV) and Chikungunya virus (CHIKV) are arboviruses infect human living in tropical and subtropical countries. These two viruses are transmitted by the same vector, Aedes aegypti mosquito. DENV and CHIKV infection induce unique immune response characterized by the secretion of cytokines, chemokines, and growth factors as inflammatory mediators. This immune response produces similar clinical symptoms, therefore it is difficult to distinguish between DENV and CHIKV infection. This study was aimed to compare the expression profiles of cytokine/chemokine expression in A549 and HepG2 cell lines infected with DENV and CHIKV. The study used Fluorescence Activated Cell Sorter (FACS) method to determine the infection rate in cell line and Enzyme Linked Immunosorbent (ELISA) for cytokine/chemokine analyses. The FACS results showed the tropism DENV in A549 cells and CHIKV in HepG2 cells. Among four cytokines and chemokines examined, i.e. IL-8, IL-4, IL-13, and MCP-3, significant different in expression was observed for IL-8 and MCP-3. The IL-8 expression was higher in A549 than HepG2 cells, whereas the profile of MCP-3 expression was higher in HepG2 than that in A549 cells. The IL-8 and MCP-3 expression was higher in cell lines infected with DENV (DENV-4) than CHIKV. This study demonstrated the differences of cytokine/chemokine expression in A549 and HepG2 cell lines infected with DENV and CHIKV."

"ABSTRAK<Kasus dengue masih tinggi di negara-negara endemik, salah satunya Indonesia. Tingkat insidensi penyakit demam berdarah dengue meningkat sejak tahun 1968 sampai 2015. Hingga saat ini belum ada obat antivirus spesifik untuk infeksi dengue. Salah satu penelitian mengenai pengobatan dengue dilakukan dengan menggunakan bahan natural. Penelitian sebelumnya menunjukkan bahwa fraksi n-heksana ekstrak daun kenikir memiliki potensi sebagai antivirus DENV dengan nilai IC50, CC50, dan SI sebesar 1.497 μg/ml, 33.247 μg/ml dan 22.209 secara berurutan. Akan tetapi, bagaimana mekanisme penghambatan replikasi DENV paling tepat belum diketahui. Penelitian ini merupakan studi eksperimental menggunakan DENV Serotipe 2 Strain NGC dan sel HUH7it-1 yang membandingkan 2 mekanisme hambatan yaitu sesudah infeksi (post infeksi) dan saat-sesudah infeksi (pre-post infeksi). Penentuan persentase penghambatan DENV menggunakan uji focus assay. Sedangkan penentuan persentase viabilitas sel HUH7it-1 menggunakan uji MTT yang dibandingkan dengan nilai viabilitas kontrol DMSO untuk mengetahui efek toksisitas ekstrak. Dari uji tersebut, didapatkan persentase penghambatan DENV dan viabilitas pada mekanisme sesudah infeksi adalah 15,43% dan 138,53%. Sedangkan persentase penghambatan DENV dan viabilitas pada mekanisme saat-sesudah infeksi adalah 6,44% dan 118,12%. Hasil tersebut menunjukkan bahwa mekanisme penghambatan antivirus ekstrak daun kenikir fraksi n-heksana adalah pada sesudah infeksi virus

---

ABSTRACTDengue cases are still high in endemic countries, one of them is Indonesia. The incidence rate of dengue hemorrhagic fever had been increasing since 1968 to 2015. Until now, specific antiviral drug for dengue infection has not been found. One of the research about dengue treatment used natural products. A recent study showed that n-hexane fraction of Cosmos caudatus had the potency of being DENV antiviral drug with the value of IC50, CC50 and SI, 1.497 μg/ml, 33.247 μg/ml and 22.209, respectively. However, the inhibitory mechanism of DENV replication has not been known. This is an experimental study using DENV Serotype 2 Strain NGC and HUH7it-1 cell line that compare 2 inhibitory mechanism, which are post infection and pre-post infection. The inhibitory percentage use focus assay test. And the viability perventage of HUH7it-1 cell is measured by MTT assay to determine the toxicity effect of the extract. From this experiment, the inhibitory percentage of DENV and viability of cell from the post-infection mechanism are 15,43% and 138,53% respectively. Meanwhile the inhibitory percentage and viability from the pre-post infection mechanism are 6,44% and 118,12%. This shows that the inhibitory antiviral mechanism of Cosmos caudatus leaves n-hexane fraction with higher effects is post infection."

"Latar belakang: Infeksi Human Papilloma Virus (HPV) merupakan salah satu faktor etiologi KSS (Karsinoma Sel Skuamosa) kepala dan leher serta mempengaruhi hasil terapi. Hipoksia tumor menunjukkan respon terapi yang buruk pada sebagian besar keganasan, termasuk KSS. Studi ini bertujuan mengevaluasi karakteristik HPV dan hipoksia dalam KSS rongga mulut dan orofaringeal serta kaitannya terhadap respons radiasi.Metode: Penelitian eksperimental pada KSS rongga mulut dan orofaring yang telah menjalani terapi radiasi di Departemen Radioterapi antara Januari 2013 hingga Desember 2017.Hasil: Dari total 18 subjek, 44,4% memiliki infeksi HPV positif, 66,7% menunjukkan marker hipoksia positif. Hubungan infeksi HPV dan hipoksia dalam penelitian ini menunjukkan tidak ada hubungan yang signifikan (OR HPV = 2,0 (0,2-15,3), OR hipoksia positif = 0,6 (0,15-2,5), atau hipoksia negatif = 1,2 (0,6-2,3), p = 0,638). Dalam penelitian ini, enam pasien (33,3%) memiliki respon lengkap, tujuh pasien (38,8%) memiliki respon parsial, satu pasien memiliki respon stabil, dan empat pasien (22,2%) memiliki respon progresif terhadap radiasi. Tidak ada hubungan yang signifikan antara HPV + / hipoksia +, HPV + / hipoksia-, HPV- / hipoksia +, dan kelompok HPV- / hipoksia- terhadap tanggapan terapi (p = 0,514).Kesimpulan: Peningkatan insiden HPV dan hipoksia tumor yang tinggi pada pasien dengan rongga mulut dan kanker orofaringeal. Namun, tidak ada efek signifikan dari HPV dan tumor hipoksia terhadap respons radiasi. Hipoksia berhubungan dengan respon progresif.

---

Background: Human Papilloma Virus (HPV) infection can lead to head and neck cancer and affect therapy outcomes. Hypoxic tumors are known to show poor therapy response in majority of malignancies, including Squamous Cell Carcinoma (SCC). This study aimed to show characteristics of HPV and hypoxia in oral cavity and oropharyngeal cancer and their association in radiation response.

Method: We conducted an experimental study on patients diagnosed with oral cavity cancer and oropharyngeal cancer who had undergone radiation therapy in Radiotherapy Department between January 2013 until December 2017.

Result: From a total of eighteen subjects, 44.4% had positive HPV infection, 66.7% had positive for hypoxia.. The association of HPV infection and hypoxia in this study showed no significant relationship (OR HPV = 2.0(0.2-15.3), OR positive hypoxia = 0.6(0.15-2.5), OR negative hypoxia = 1.2(0.6-2.3), p=0.638). In this study, six patients (33.3%) had complete response, seven patients (38.8%) had partial response, one patient (5.6%) had stable response and four patients (22.2%) were progressive respon to the radiation. There was also no statistically significant association between HPV+/hypoxia+, HPV+/hypoxia-, HPV-/hypoxia+, and HPV-/hypoxia- group against therapy responses (p=0.514). In this study all progressive response related with hypoxia status.

Conclusion: There were high incidences of HPV and tumor hypoxia in patients with oral cavity and oropharyngeal cancer. However, there was no significant effects of HPV and tumor hypoxia to final radiation response. Hypoxia related to progressive disease. "

"Latar belakang: Kanker nasofaring merupakan keganasan yang unik dimana angka kejadiannya termasuk jarang disebagian besar negara, namun endemis di wilayah tiongkok selatan, dan asia tenggara termasuk Indonesia. Histopatologi kanker nasofaring di daerah endemik biasanya merupakan karsinoma jenis tidak berkeratin tidak berdiferensiasi dan selalu terkait dengan infeksi EBV. Berbagai jenis protein virus diekspresikan pada infeksi laten EBV termasuk EBNA1 dan LMP1 mungkin berkontribusi dalam perkembangan kanker. Oleh karenanya, kami ingin menginvestigasi peran onkoprotein virus tersebut terhadap agresivitas dan respon terapi kanker nasofaring. Metode: Spesimen biopsi jaringan dan darah yang diambil dari pasien kanker nasofaring diukur kadar EBNA1 dan LMP1 dengan menggunakan pemeriksaan ELISA kit masing-masing dari DRG® dan MyBioSource® kemudian dikorelasikan dengan voume tumor dan KGB terlibat yang dinilai berdasarkan delineasi berbasis pencitraan 3D. Pasien kemudian menjalani terapi standar, dan dilakukan penilaian 3 bulan paska terapi. Respon terapi akan dinilai hubungannya dengan kadar EBNA1 dan LMP1. Hasil: 23 subjek dimasukan kedalam studi, 69,5% berada pada stadium IVA keatas, dengan mayoritas laki-laki sebanyak 61%. Median volume tumor primer dan volume KGB masing masing 41,4cc (13,2-128,8) dan 40,1cc (1,2-633,5). Uji korelasi Spearman mendapatkan hubungan bermakna (p=0,032) antara kadar LMP1 jaringan dan volume tumor sebelum terapi (r=0,448). Tren korelasi yang moderat terlihat pada kadar EBNA1 di jaringan dengan di darah, kadar EBNA1 di jaringan dengan volume tumor primer, kadar EBNA1 di darah dengan volume KGB, serta Kadar LMP1 baik di jaringan maupun di darah dengan volume KGB, meskipun secara keseluruhan tidak bermakna secara statistik. Sementara itu, pengaruh kadar LMP1 dan EBNA1 terhadap respon terapi belum dapat disimpulkan. Kesimpulan: Semakin tinggi kadar LMP1 di jaringan tumor akan diikuti oleh semakin besarnya volume tumor primer nasofaring. Korelasi moderat tidak signifikan pada variabel lain mungkin diakibatkan oleh jumlah sampel yang kurang. Penambahan besar sampel diperlukan untuk konfirmasi signifikansi dari korelasi tersebut.

---

Background: Nasopharyngeal cancer is an unique malignancy where the incidence is rare in most countries but endemic in Southern China and Southeast Asia, including Indonesia. The histopathology of nasopharyngeal cancer in endemic areas is usually an undifferentiated nonkeratinizing type carcinoma and is always associated with EBV infection. Various viral proteins are expressed in latent EBV infection, including EBNA1 and LMP1. These viral oncoproteins may contribute to cancer development, but they are not always be defined. Therefore, we want to investigate the role of these viral oncoproteins when it comes to the aggressivity and treatment response of nasopharyngeal cancer.

Methods: Tissue biopsy and blood specimens taken from nasopharyngeal cancer patients were measured for EBNA1 and LMP1 using the ELISA kit examination from DRG® and MyBioSource® respectively, then correlated with primary tumor and nodal volume, which was calculated by delineation based on 3D imaging. Patients then underwent standard therapy, and was assessed 3 months post-therapy. Response to therapy will be assessed in relation to levels of EBNA1 and LMP1.

Results: 23 subjects were included in the study, 69.5% was at stage IVA and above with the majority being males (61%). The median primary tumor and lymph node volume were 41.4cc (13.2-128.8) and 40.1cc(1,2-633.5), respectively. Spearman correlation test found a significant relationship (p=0.032) between tissue LMP1 levels and tumor volume before therapy (r=0.448). A moderate correlation trend was seen in EBNA1 levels in tissue with blood, EBNA1 levels in tissue with primary tumor volume, EBNA1 levels in blood with lymph node volume, and LMP1 levels both in tissue and in blood with lymph node volume, although overall it was not statistically significant. Meanwhile, the effect of LMP1 and EBNA1 levels on the response to therapy cannot be concluded.

Conclusion: The higher the level of LMP1 in the tumor tissue, the larger the volume of primary nasopharyngeal tumor will be. Moderately insignificant correlation on the other variables may be caused by a small number of samples. The addition of the sample size is needed to confirm the significance of the correlation."

"Latar belakang. Infeksi HIV dapat memicu inflamasi kronik dan reaktifasi CMV yang dan dapat mempengaruhi limfosit T. Gambaran seperti ini juga ditemukan pada usia lanjut dan berhubungan dengan penyakit degeneratif termasuk gangguan kognitif. Penelitian ini bertujuan untuk mengetahui pengaruh CMV dan limfosit T terhadap fungsi kognitif pada pasien HIV usia muda.Metode. JakCCANDO JAKarta CMV and Candida in HIV patients on ART, evaluation in CArdiology, Neurocognitive, Dentistry and Ophthalmology study, merupakan studi prospektif yang dilakukan di RSUPN. dr. Cipto Mangunkusumo. Studi ini melibatkan 80 pasien HIV 19-44 tahun yang belum pernah mendapat terapi antiretroviral ARV dengan limfosit T CD4

---

Background. HIV can trigger chronic inflammation and CMV reactivation that affect T cell. These feature is also found in old age population and associated with degenerative disease including cognitive impairment. In this study we investigated the effects of CMV and T cells on cognitive function of younger HIV patients.Methods. JakCCANDO JAKarta CMV and Candida in HIV patients on ART, evaluation in CArdiology, Neurocognitive, Dentistry and Ophthalmology is a prospective study of patients at Cipto Mangunkusumo hospital. This study involved 80 HIV antiretroviral therapy ART naive patients 19 44 years with baseline CD4 T cell counts "

"ABSTRAK<

Karsinoma hepatoseluler (KHS) merupakan karsinoma primer tersering pada sel hati. Sebagian besar KHS disebabkan oleh virus hepatitis B (VHB) dan virus hepatitis C (VHC) yang memiliki patogenesis yang berbeda dalam menyebabkan KHS. Alfa-fetoprotein (AFP) sebagai penanda tumor pada KHS dan dipengaruhi oleh berbagai faktor, salah satunya status infeksi. Berbagai penelitian sudah dilakukan untuk mengetahui pengaruh pengaruh jenis virus penyebab KHS dengan kadar AFP namun hasilnya sangat beragam. Berdasarkan hal tersebut dan ditambah dengan belum adanya penelitian serupa yang menggunakan data pasien di Indonesia maka penelitian ini bertujuan untuk membandingkan kadar AFP pada pasien KHS terkait infeksi VHB terhadap VHC. Penelitian ini dilakukan dengan desain studi potong lintang menggunakan 199 data AFP pasien KHS yang terdiri dari 129 kasus KHS terkait VHB dan 70 kasus KHS terkait VHC. Dari penelitian ini didapatkan sebanyak 97% dan 87.3% pasien KHS terkait VHC dan VHB mengalami peningkatan kadar AFP secara berurutan. Nilai median kadar AFP pada pasien KHS terkait VHB adalah 419 IU/mL sedangkan pada pasien KHS terkait VHC sebesar 400 IU/mL. Perbedaan nilai tersebut memiliki nilai p = 0.97 dalam uji Mann-Whitney U sehingga disimpulan tidak ada perbedaan bermakna pada rerata kadar AFP antara pasien KHS terkait VHB dibanding dengan VHC.

---

ABSTRACT

Hepatocellular carcinoma (HCC) is the most primary common carcinoma in liver cells. Most HCC are caused by the hepatitis B virus and hepatitis C that have different pathogenesis in causing carcinoma. Alpha-fetoprotein as tumor marker in HCC is influenced by various factors, one of which is infection status. Various studies have been carried out to determine the influence of the types of viruses causing HCC with AFP levels but the results are very diverse. Based on this and coupled with the absence of similar studies using patient data in Indonesia, this study aims to compare AFP levels in HCC patients related to HBV and HCV. Using cross-sectional design, this study included 199 data of AFP in patient with HCC comprises of 129 cases of HCC related to HBV and 70 cases of HCC related to HCV. From this study, it was found that 97% and 87.3% of HCC patients related to HCV and HBV experienced an increase in AFP levels consecutively. The median value of AFP levels in HBV-related HCC patients was 419 IU / mL while in HCV-related HCC patients was 400 IU / mL. The difference in value has a p value = 0.97 in the Mann-Whitney U test thus it is concluded that there is no significant difference in AFP levels between HBV-related HCC patients compared with HCV-related HCC.

"

"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

---

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."