Hasil Pencarian  ::  Simpan CSV :: Kembali

"[ABSTRAKLatar belakang: Tinggi badan/ perawakan tubuh merupakan parameter penting tingkat kesejahteraan suatu populasi. Perawakan tubuh dipengaruhi oleh faktor genetik, endokrin dan lingkungan. Faktor lingkungan yang saat ini paling sering ditemukan adalah faktor nutrisi. Populasi pigmi adalah suatu populasi terisolasi yang seluruh anggotanya pendek dan ditemukan di berbagai belahan dunia termasuk Indonesia, yaitu di Flores, Nusa Tenggara Timur yang disebut komunitas pigmi Rampasasa. Sampai saat ini belum ada penelitian yang dapat menemukan penyebab perawakan pendek komunitas pigmi tersebut.Tujuan: Mengetahui profil antropometri manusia pigmi Rampasasa dan mencari berbagai faktor (genetik, endokrin, dan nutrisi) yang berperan dalam perawakan pendek komunitas pigmi tersebut sehingga diharapkan dapat berkontribusi dalam tatalaksana perawakan pendek pada umumnya.Metode: Penelitian merupakan studi deskriptif analitik yang dilakukan pada periode Desember 2011-April 2014. Penelitian ini menggunakan desain potong lintang untuk mengetahui profil genetik dan non genetik (endokrin dan nutrisi) yang berperan dalam perawakan pendek manusia pigmi Rampasasa. Dilakukan pengukuran antropometri pada subjek dan pengambilan sampel darah. Analisis statistik dilakukan dengan uji ANOVA yang dilanjutkan dengan post hoc analysis. Analisis genetik dilakukan dengan mengirimkan isolasi DNA ke Laboratory for Diagnostic Genome Analysis (LDGA), Leiden, Belanda.Hasil: Didapatkan data dari 58 subjek yang dikelompokkan menjadi pigmi murni (n=8), pigmi campuran (n=40), dan non pigmi (n=10). Seluruh subjek memiliki proposi tubuh yang normal. Tidak terdapat perbedaan bermakna untuk status nutrisi antara ketiga kelompok, yang dinyatakan dengan kadar kalsium (p=0,19), vitamin D (p=0,96), dan hemoglobin (p=0,147). Namun didapatkan perbedaan bermakna untuk kadar hormon IGF-1 antara ketiga kelompok (p=0,037), yang setelah dilakukan analisis posthoc menunjukkan perbedaan hanya pada kelompok non pigmi vs. pigmi murni (p=0,012). Kadar hormon IGFBP-3 tidak menunjukkan perbedaan bermakna antara ketiga kelompok (p=0,772). Analisis DNA menggunakan SNP array mengidentifikasi 10 regio homozigot pada sampel pigmi yang tidak didapatkan pada kontrol.Simpulan: Perawakan pendek manusia pigmi Rampasasa memiliki proporsi tubuh yang normal. Faktor nutrisi tidak berhubungan dengan perawakan pendek komunitas pigmi Rampasasa. Faktor hormonal tidak dapat menjelaskan perawakan pendek populasi tersebut. Temuan regio homozigot mengindikasikan pengaruh faktor genetik meskipun kandidat gen belum dapat diidentifikasi.;

---

ABSTRACTBackground: Height / stature of the body is an important parameter of one?s population wellbeing. Height is influenced by genetic, endocrine and environmental factors. Nutritional factor is one of the most common environmental factors found. Pygmy population is an isolated population whose all members have short stature. They are found in various parts of the world including Indonesia, namely Rampasasa pygmies community in Flores, East Nusa Tenggara. Up until this date, there are no studies about the etiology of Rampasasa pygmies short stature.Objective: To learn about anthrophometric profiles in Rampasasa Pygmies and factors involved in the short stature of that pygmy community, as a contribution to the management of short stature in general, as well as to provide scientific asset about Rampasasa pygmies.Keywords: calsium, genetic factors, height, IGFBP-3, IGF-I, nutrition, Rampasasa pygmies, short stature, vitamin D.Methods: This research is a descriptive analytic study conducted from December 2011 toApril 2014. This study used a cross-sectional design to determine the genetic and non-genetic profile (endocrine and nutrition) that play role in Rampasasa pygmies shortstature. Anthropometric measurements and blood sampling were performed. Statisticalanalysis was performed by using ANOVA followed by post hoc analysis. Geneticanalysis is done by sending DNA isolation to Laboratory for Diagnostic GenomeAnalysis (LDGA), Leiden, The Netherlands.Results: Data obtained from 58 subjects were grouped into pure pygmies (n = 8), mixedpygmy (n = 40), and non- pygmies (n = 10). All subjects had normal body proportions.There were no significant difference in nutritional status between three groups, which isexpressed by calcium level (p = 0.19) , vitamin D (p = 0.96), and hemoglobin (p = 0.147).Significant difference of IGF-1 hormone were found between the three groups (p =0.037), which after posthoc analysis showed differences only between non-pygmies vs.pure pygmies (p = 0.012). IGFBP-3 hormone level showed no significant differenceamong the three groups (p = 0.772). We obtained evidence of homozygous regions inDNA analysis using SNP arrays method, which are not found in control group.Conclusion: Rampasasa pygmies have short stature with normal body proportion.Nutritional factors are not associated with short stature of Rampasasa pygmycommunities. Hormonal factors can not explain the cause of the population short stature.The discovery of homozygous regions indicates the role of genetic cause even thoughthere were no specific genes to be identified in this study.;Background: Height / stature of the body is an important parameter of one?s population wellbeing. Height is influenced by genetic, endocrine and environmental factors. Nutritional factor is one of the most common environmental factors found. Pygmy population is an isolated population whose all members have short stature. They are found in various parts of the world including Indonesia, namely Rampasasa pygmies community in Flores, East Nusa Tenggara. Up until this date, there are no studies about the etiology of Rampasasa pygmies short stature.Objective: To learn about anthrophometric profiles in Rampasasa Pygmies and factors involved in the short stature of that pygmy community, as a contribution to the management of short stature in general, as well as to provide scientific asset about Rampasasa pygmies.Keywords: calsium, genetic factors, height, IGFBP-3, IGF-I, nutrition, Rampasasa pygmies, short stature, vitamin D.Methods: This research is a descriptive analytic study conducted from December 2011 toApril 2014. This study used a cross-sectional design to determine the genetic and non-genetic profile (endocrine and nutrition) that play role in Rampasasa pygmies shortstature. Anthropometric measurements and blood sampling were performed. Statisticalanalysis was performed by using ANOVA followed by post hoc analysis. Geneticanalysis is done by sending DNA isolation to Laboratory for Diagnostic GenomeAnalysis (LDGA), Leiden, The Netherlands.Results: Data obtained from 58 subjects were grouped into pure pygmies (n = 8), mixedpygmy (n = 40), and non- pygmies (n = 10). All subjects had normal body proportions.There were no significant difference in nutritional status between three groups, which isexpressed by calcium level (p = 0.19) , vitamin D (p = 0.96), and hemoglobin (p = 0.147).Significant difference of IGF-1 hormone were found between the three groups (p =0.037), which after posthoc analysis showed differences only between non-pygmies vs.pure pygmies (p = 0.012). IGFBP-3 hormone level showed no significant differenceamong the three groups (p = 0.772). We obtained evidence of homozygous regions inDNA analysis using SNP arrays method, which are not found in control group.Conclusion: Rampasasa pygmies have short stature with normal body proportion.Nutritional factors are not associated with short stature of Rampasasa pygmycommunities. Hormonal factors can not explain the cause of the population short stature.The discovery of homozygous regions indicates the role of genetic cause even thoughthere were no specific genes to be identified in this study., Background: Height / stature of the body is an important parameter of one’s population wellbeing. Height is influenced by genetic, endocrine and environmental factors. Nutritional factor is one of the most common environmental factors found. Pygmy population is an isolated population whose all members have short stature. They are found in various parts of the world including Indonesia, namely Rampasasa pygmies community in Flores, East Nusa Tenggara. Up until this date, there are no studies about the etiology of Rampasasa pygmies short stature.Objective: To learn about anthrophometric profiles in Rampasasa Pygmies and factors involved in the short stature of that pygmy community, as a contribution to the management of short stature in general, as well as to provide scientific asset about Rampasasa pygmies.Keywords: calsium, genetic factors, height, IGFBP-3, IGF-I, nutrition, Rampasasa pygmies, short stature, vitamin D.Methods: This research is a descriptive analytic study conducted from December 2011 toApril 2014. This study used a cross-sectional design to determine the genetic and non-genetic profile (endocrine and nutrition) that play role in Rampasasa pygmies shortstature. Anthropometric measurements and blood sampling were performed. Statisticalanalysis was performed by using ANOVA followed by post hoc analysis. Geneticanalysis is done by sending DNA isolation to Laboratory for Diagnostic GenomeAnalysis (LDGA), Leiden, The Netherlands.Results: Data obtained from 58 subjects were grouped into pure pygmies (n = 8), mixedpygmy (n = 40), and non- pygmies (n = 10). All subjects had normal body proportions.There were no significant difference in nutritional status between three groups, which isexpressed by calcium level (p = 0.19) , vitamin D (p = 0.96), and hemoglobin (p = 0.147).Significant difference of IGF-1 hormone were found between the three groups (p =0.037), which after posthoc analysis showed differences only between non-pygmies vs.pure pygmies (p = 0.012). IGFBP-3 hormone level showed no significant differenceamong the three groups (p = 0.772). We obtained evidence of homozygous regions inDNA analysis using SNP arrays method, which are not found in control group.Conclusion: Rampasasa pygmies have short stature with normal body proportion.Nutritional factors are not associated with short stature of Rampasasa pygmycommunities. Hormonal factors can not explain the cause of the population short stature.The discovery of homozygous regions indicates the role of genetic cause even thoughthere were no specific genes to be identified in this study.]"

"ABSTRAKLatar Belakang : Tuberkulosis (TB) adalah penyakit infeksi menular yang disebabkan oleh bakteri Mycobacterium tuberculosiss (MTB) dan merupakan masalah kesehatan utama didunia.1World Health Organization (WHO) pada tahun 2018 melaporkan 10 juta orang terdiagnosis TB di seluruh dunia. Indonesia merupakan negara dengan insiden TB tertinggi ketiga di dunia, terjadi peningkatan kasus baru sebesar 70% dari 331.703 menjadi 563.879 antara tahun 2015-2018 dan kasus TB MDR/TB RR, rata-rata 8.8 per 100.000 populasi, 2.4 % merupakan kasus baru dan dan 13% merupakan TB pengobatan ulang.2Berdasarkan data WHO tingkat kegagalan pengobatan pada pasien TB MDR cukup besar (lebih dari 50%), juga terjadi di Indonesia yang disebabkan tinggi nya angka kematian (17%) dan loss to follow up (26%). Kegagalan pengobatan mengakibatkan pengobatan dihentikan dan diperlukan penggantian rejimen. Komorbiditas, Efek samping obat, resistensi obat merupakan faktor yang mempengaruhi kegagalan pengobatan dan dinilai melalui konversi sputum yang merupakan indikator respons pengobatan dan digunakan sebagai indikator keberhasilan pengobatan atau kegagalan pengobatan.Tujuan : Mengetahui hubungan konversi sputum pasien TB MDR dengan berbagai faktor non genetic dan genetic yang terjadi selama fase intensif yang sedang diobati di RS paru DR.M.Goenawan Partowidigdo.Metode: Data diambil secara kohort retrospektif melalui rekam medis TB MDR (1 Oktober 2018 sampai 31 Maret 2019). Data yang terkumpul dilakukan uji statistik.Hasil : SP yang mendapat terapi jenis STR memiliki karakteristik rerata usia sebesar 35,11 tahun dengan jenis kelamin laki-laki sedikit lebih banyak dibanding perempuan (57,9% vs 42,1%), sebagian besar memiliki riwayat pengobatan TB sebelumnya (84,2%) namun tidak memiliki riwayat kontak dengan pasien TB aktif (87,7%). Terdapat 32 SP yang tidak memiliki riwayat pengobatan dan tidak memiliki riwayat kontak tetapi terinfeksi kuman TB MDR sebanyak sepertiga SP memiliki komorbiditas DM.SP yang mendapat terapi jenis konvensional memiliki karakteristik rerata usia sebesar 40,22 tahun, lebih banyak berjenis kelamin laki-laki (61,5%), dengan riwayat pengobatan TB sebelumnya (73,5%) namun tidak memiliki riwayat kontak dengan pasien TB aktif (86,3%), sebanyak sepertiga SP memiliki komorbiditas DMSubjek yang tidak mememiliki komorbiditas dan tidak konversi sputum sebesar 18,4% sedangkan yang tidak memiliki komorbiditas dan tidak konversi sputum sebesar 55,2% dimana hasil ini bermakna secara statistik (p=0,016, RO 2,23 IK95% 1,15 - 4,32). SP dengan DM memiliki risiko 2,23 kali untuk tidak terjadi konversi sputum. Jumlah efek samping obat anti tuberkulosis lebih dari 2 jenis yang mengalami konversi sputum sebesar 43,1 % sedangkan yang jumlah efek sampingnya ≤ 2 mengalami konversi sputum sebesar 23,6 % dimana hasil ini bermakna secara statistik (p<0,001, RO 0,11 IK95% 0,05 -0,25). Pada akhir bulan keenam dan dilakukan kultur dan DST dan LPA lini dua didapatkan perubahan sifat resistensi, bisa akibat mutasi atau pasien terinfeksi oleh 2 strain yang berbeda.Kesimpulan: Konversi kultur sputum yang tertunda mengakibatkan waktu pengobatan yang diperpanjang dan beresiko kegagalan pengobatan. DM, efek samping onat dan resistensi adalah salah satu Faktor yang menyebabkan waktu konversi sputum lebih lama, sehingga resiko kegagalan terapi menyebabkan resiko mortalitas meningkat.

---

ABSTRACTBackground: Tuberculosis (TB) is an infection caused by Mycobacterium tuberculosis (MTB) and is a main health problem in the world.1 The World Health Organization (WHO) in 2018 reported 10 million people diagnosed with TB worldwide. Indonesian is country with the third highest incidence of TB in the world, an increase in new cases is 70% from 331,703 to 563,879 between 2015-2018 and MDR TB cases an average of 8.8 per 100,000 population, 2.4% is a new cases and 13% is a re-treatment of TB cases.2Based on WHO data, the treatment failure rate in MDR TB patients is quite large (more than 50%), also occurring in Indonesia which causes high mortality (17%) and loss to follow-up (26%). Treatment failure causes the treatment being stop and replacement regimen are needed. Many factors that influence treatment and approved through sputum conversion which is an indicator of treatment response and is used as an indicator of treatment success or treatment failure.Objective: To know the relation of sputum conversion in patients with various factor non genetic and genetic that occur during intensive phase while in the process of treatment in pulmonary hospital of Dr. M. Goenawan Partowidigdo.Methods: Data were collected in retrospective cohort through MDR TB medical records (1 October 2018 until 31 March 2019). The data collected is done by statistical tests.Results: SP who received STR type therapy had characteristic a mean age of 35.11 years with sex of male more slightly than female (57.9% vs 42.1%), most had a history medication of previous treatment TB (84, 2%) but do not have a contact history with active TB patients (87.7%). There were 32 SPs who had no history of treatment and had no contact history but were infected with MDR TB as much as one third of SP have comorbid DM.SP who received individua type of therapy had a mean age of 40.22 years, most are male (61.5%), with a history of previous TB treatment (73.5%) but had no contact history with active TB patients (86.3%), as many as one third of SP have comorbid DM.Subjects who did not have comorbidity and no sputum conversion were 18.4% while those who did not have comorbidity and had no sputum conversion were 48.9% where these results were statistically significant (p = 0.016, RO 2.23 IK95% 1.15 - 4 , 32). SP with DM has a risk of 2.23 times for not occur sputum conversion. The number of side effects of anti tuberculosis drugs more than 2 types be through sputum conversion was 43.1% while the number of side effects ≤ 2 be through sputum conversion was 23.6% where these results were statistically significant (p <0.001, RO 0.11 IK95 % 0.05 - 0.25). At the end of the sixth month and culture had be done and DST and LPA line two, there was a change of characteristic resitence, it could be due to mutations or the patient was infected by 2 different strains.Conclusion: Delayed conversion of sputum culture causes the time extended of treatment and risk treatment failure. DM, drugs side effects and resistance are one of the factors that cause a longer sputum conversion time, so the risk of therapy failure causes an increased risk of mortality."

"ABSTRAKPulau Enggano terletak paling selatan dari busur kepulauan sebelah pantai barat Sumatra. Penduduk aslinya, atau juga Suku Bangsa Enggano merupakan populasi yang terisolasi dan tidak diketahui sejarah asal usulnya serta tidak memiliki keterkaitan bahasa dan kebudayaan dengan populasi penutur bahasa Austronesia di Nusantara, khususnya di Sumatra. Kami menganalisis daerah kontrol DNA mitokondria (mtDNA) dari 29 individu Enggano dan membandingkannnya dengan populasi lainnya di Nusantara dan juga Daratan Asia Tenggara untuk melihat sejarah asal usul serta keterkaitannya dengan populasi penutur bahasa Austronesia. Kami menemukan bahwa pada populasi Enggano tidak ditemukan penanda genetik populasi penutur bahasa Austronesia. Akan tetapi, Suku Bangsa Enggano memiliki nenek moyang yang sama dengan populasi-populasi di wilayah Daratan Asia Tenggara yang diperkirakan berumur sekitar 30.000 tahun yang lalu.Meskipun demikian, Suku Bangsa Enggano merupakan populasi yang bermigrasi pada masa pertengahan Holosen bersamaan ketika naiknya permukaan air laut di Paparan Sunda dan berdekatan dengan ekspansi populasi penutur bahasa Austronesia yang berasal dari Taiwan. Kami juga menemukan bahwa Suku Bangsa Enggano memiliki diversitas genetik dan pertumbuhan populasi yang rendah sebagai hasil konstribusi isolasi geografis.

---

ABSTRACT

Enggano Island located at the southern most of the west coast islands of Sumatra. The original inhabitants, which also known as the Engganese people, are one of the most isolated populations and their history of origin is unknown. They have no similar language and culture with Austronesian-speaking populations in the Island Southeast Asia, particularly Sumatra. We analyzed the mitochondrial DNA (mtDNA) control region from 29 individuals and compared the result with other populations in Mainland and Island Southeast Asia to observe their history of origin and relation to Austronesian-speaking populations.

However, we found that there was no Austronesian maternal genetic ancestry in Enggano. Instead, the Engganese has a common ancestor with Mainland Southeast Asia population ranging back to 30.000 years ago. However, the Enggano people are a relatively new population who migrated during the mid-Holocene as Sundaland was flooded and adjacent to the expansion of Austronesian-speaking populations originating from Taiwan. We also found that they have low population growth and genetic diversity as a result of geographical isolation."

"ABSTRAKPenelitian terkait karakteristik genetik sekuens virus dengue (DENV) diperlukan dalam menilai kekerabatan antara strain DENV yang tersebar di seluruh dunia. Tujuan dalam penelitian ini adalah membandingkan karakteristik genotype dan sekuens data DENV serotipe 2 (DENV-2) nukleotida envelope dibandingkan dengan sekuens data DENV-2 nukleotida Non-Struktural 1 (NS1). Data didapatkan dari Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia untuk strain data yang berasal dari Indonesia dan GenBank untuk strain data yang berasal dari seluruh dunia sebagai data pembanding dengan jumlah sebanyak 42 data, yang kemudian dianalisis menggunakan Genetyx 5.1. Hasil penelitian didapatkan bahwa sekuens data NS1 strain DENV-2 yang berasal dari Indonesia termasuk ke dalam kelompok genotype Cosmopolitan, serupa dengan hasil analisis data dengan sekuens data envelope strain DENV-2. Sementara pada analisis epitope LX1 yang merupakan epitope khas dari NS1, terdapat berbagai peubahan komponen asam amino pada epitope tersebut dibandingkan dengan sekuens data strain Indonesia yang tergabung ke dalam kelompok genotype Cosmopolitan. Kesimpulan dari penelitian ini adalah bahwa filogenetik dengan menggunakan NS1 sebagai bahan analisis dapat digunakan untuk menentukan genotipe. Sehingga gen NS1 pada DENV-2 strain Indonesia masih dapat dipertimbangkan sebagai salah satu dasar metode pengembangan vaksin.

---

ABSTRACTStudies about genetic characteristic between dengue virus serotype 2 (DENV-2) sequence data is needed to determine its relationship between DENV strain over the world. The main purpose of this study is to compare between characteristic of sequence data DENV-2 envelope nucleotide and sequence data DENV-2 Non- Structural 1 (NS1) nucleotide, and analyze between amino acid homology in this study and related previous studies. 42 data used for this study are obtained from Laboratory of Microbiology Faculty of Medicine University of Indonesia for data from Indonesia and form GenBank for data from other countries as a comparison, which is analyzed with software Genetyx 5.1. NS1 sequence data from DENV-2 strain from Indonesia is classified in Cosmpolitan genotype group, which are similar than data analysis from envelope sequence data from same data. Meanwhile in analysis of LX1 epitope, which is considered as typical epitope from NS1, there are any differences in amino acid component at it compared than strain Indonesia data sequences which are included in Cosmopolitan genotype group. As a conclusion, phylogenetic analysis of NS1 nucleotide is useful for determining the genotypes, which means NS1 DENV-2 gene strain Indonesia can be useful as the basis for vaccine development"

"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

---

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."

"Kementerian Kelautan dan Perikanan Indonesia menetapkan Lutjanus boutton sebagai salah satu spesies kakap yang diprioritaskan dalam manajemen perikanan Indonesia pada tahun 2021. Akan tetapi, L. boutton tidak termasuk ke dalam daftar Lutjanus sp. yang diperjualbelikan di pasar ikan Indonesia, melainkan hanya L. rufolineatus. Penelitian bertujuan untuk mengonfirmasi keberadaan kedua spesies berdasarkan jarak genetik dan potensi hibridisasi. Total 43 sampel telah melalui tahap ekstraksi DNA, PCR, elektroforesis, dan sekuensing. Analisis dilakukan dengan identifikasi, peta haplotipe, rekonstruksi pohon filogenetik, analisis sekuens, dan analisis morfometrik. Sebanyak 90,7% sekuens COI memiliki kemiripan hingga 100% dengan L rufolineatus, didukung oleh pembentukan klaster pada haplotipe, pohon filogenetik, dan analisis morfometrik PCA (principal component analysis). Analisis sekuens RAG1 menemukan ada lima situs polimorfik Y (C/T). Basa polimorfik Y di situs ke-5 yang ditemukan pada empat individu dari populasi Maluku Utara berpotensi sebagai indikasi adanya hibridisasi. Hal tersebut didukung oleh keberadaan empat dan dua individu Maluku Utara yang secara berturut-turut memiliki basa C dan basa T di situs ke-5. Meski demikian, empat individu Maluku Utara dengan potensi hibrid tidak dapat dikonfirmasi tanpa memvalidasi keberadaan L. boutton dengan galur murni sebagai parental dari hibrid generasi pertama.

---

In 2021, the Ministry of Marine and Fisheries of Indonesia considered Lutjanus boutton one of the prioritized species in Indonesia's fishery management. However, L. boutton was not included in the list of Lutjanus sp. traded in Indonesia's fish markets, but instead, L. rufolineatus. Therefore, this research aims to confirm the occurrence of both species based on genetic distance and their hybridization potential. A total of 43 samples have proceeded through DNA extraction, PCR, electrophoresis, and sequencing. The analysis includes moleculr identification, haplotype networks, phylogenetic tree reconstruction, sequence analysis, and morphometric analysis. Identification result shows that 90,7% of COI sequences have high similarity up to 100% with L. rufolineatus, supported by clustering group type in haplotype network, phylogenetic tree, and PCA. Analysis of samples RAG1 sequence shows a total of five polymorphic sites of Y (C/T) base observed. The polymorphic base Y at the 5th site that was found in four individuals from the North Maluku population has the potential to be an indication of hybridization. This is supported by the presence of four and two North Maluku individuals who respectively have base C and base T at the 5th site. However, four individuals from North Maluku with hybrid potential could not be further confirmed in this research without validating the pure breed of L. boutton as the parent of the first hybrid generation."

"Dalam penelitian ini akan membahas tentang pengembangan sistem sequencing pada kode genetik pada platform web. Sistem sequencing adalah proses untuk menentukan urutan basa nukleotida pada molekul DNA. Sistem yang dimasukkan pada input berupa empat basa nukleotida yang di translasi akan menghasilkan output berupa asam amino dan kode genetik yang di translasikan. Proses translasi pada sistem web menggunakan parameter replace. Sistem sequencing menggunakan variasi parameter sesuai dengan jenis kode genetik yang ditranslasikan. Proses konversi mengasilkan nilai rata-rata maksimum kecepatan pada web sebesar 60 fps.

---

In this research, we will discuss the development of sequencing systems on genetic codes on web platforms. The sequencing system is the process of determining the sequence of nucleotide based in DNA molecules. The system entered into the input in the form of four nucleotides based that are translated will produce an output in the form of amino acids and the translated genetic code. The translation process on the web system uses the replace parameter. The sequencing system uses variations of parameters according to the type of genetic code being translated. The conversion process produces an average value of maximum speed on the web of 60 fps."

"ABSTRAKTesis ini membahas mengenai optimasi jaringan pipa untuk distribusi gas. Nilai investasi yang terkecil merupakan tujuan dari optimasi. Hal ini dapat diperoleh dengan menggunakan diameter pipa yang paling sesuai untuk jaringan pipa dengan total cost yang paling rendah. Algoritma genetik merupakan salah satu metode yang dapat digunakan untuk melakukan optimasi.

---

Abstract

This thesis discusses the optimization of gas pipelines for distribution. The smallest investment value is the purpose of optimization. This can be obtained by using the most appropriate pipe diameter for the pipeline network and with the total lowest cost. Genetic algorithms are one of the methods that can be used to perform optimization."

"

Pendahuluan: Kelainan kromosom meningkat secara eksponensial pada ibu usia lanjut dan prevalensi dapat mencapai hingga 80% pada wanita usia 40 tahun. Oleh karena itu, PGT-A telah digunakan di rumah sakit pada pasien IVF, untuk mencegah konsekuensi yang timbul dari kelainan genetik dan mengoptimalkan hasil klinis. Faktor ibu dan faktor laki-laki yang berhubungan dengan kesuburan telah dikaitkan dengan penemuan embrio aneuploid di PGT-A, namun data masih sedikit. Tujuan penelitian ini adalah menganalisis pengaruh usia ibu, penilaian embrio, konsentrasi sperma, dan motilitas sperma pasangan terhadap hasil PGT-A. Metode: Penelitian cross-sectional ini menggunakan data rekam medis dan buku embriologi Klinik Yasmin Kencana. Sebanyak 35 pasien IVF dengan embrio tunggal yang telah menjalani PGT-A dianalisis menggunakan uji Kruskal Wallis untuk kemungkinan pengaruh usia ibu, penilaian embrio, konsentrasi sperma, dan motilitas sperma pasangan, terhadap hasil PGT-A. Untuk mengidentifikasi faktor terkuat yang terkait dengan tingkat aneuploidi, dilakukan analisis regresi logistik multivariat. Hasil: Usia ibu (p=0,033), penilaian embrio (p=0,002), konsentrasi sperma (p=0,002) dan motilitas sperma (p=0,008), memiliki hubungan yang signifikan secara statistik dengan hasil PGT-A. Faktor terkuat dalam memprediksi hasil PGT-A pasien IVF adalah penilaian embrio (B=0.593, OR=1.809, 95% CI, 0.286-0.683, p<0.001). Kesimpulan: Penelitian ini menemukan bahwa usia ibu, penilaian embrio, konsentrasi sperma dan motilitas sperma mempengaruhi hasil PGT-A.

---

Introduction: Chromosomal abnormality increases exponentially in advanced maternal age and reaches up to 80% prevalence in women ages 40. For this reason, PGT-A has been utilized in hospital settings for IVF patients, to prevent consequences arising from genetic anomalies and optimize clinical outcomes. Maternal factors and fertility-related male factors have been associated with finding an aneuploid embryo in PGT-A, yet data remain scant. The aim of this study was to analyze the influence of maternal age, embryo grading, partner’s sperm concentration and sperm motility on PGT-A results. Method: This cross-sectional study used data from Yasmin Kencana Clinic medical record and embryology book. A total of 35 single-embryo IVF patients who had undergone PGT-A were analyzed using the Kruskal Wallis test, for the possible influence of maternal age, embryo grading, partner’s sperm concentration and sperm motility on PGT-A results. For the identification of the strongest factor associated with aneuploidy rates, multivariate logistic regression analysis was performed. Results: Maternal age (p=0.033), embryo grading (p=0.002), sperm concentration (p=0.002) and sperm motility (p=0.008), have a statistically significant relationship with the PGT-A results. The strongest factor in predicting PGT-A results of IVF patients is embryo grading (B=0.593, OR=1.809, 95% CI, 0.286- 0.683, p<0.001). Conclusion: This study found that maternal age, embryo grading, sperm concentration and sperm motility influence PGT-A results.

"

"Demam berdarah merupakan salah satu masalah kesehatan di dunia. Infeksi virus dengue yang berulang dengan serotipe yang berbeda dapat memacu terjadinya demam berdarah bahkan kematian. Dengue serotipe 4 dilaporkan dapat menyebabkan infeksi sekunder yang lebih parah dibandingkan dengue serotipe lainnya. Sampai saat ini pengobatan demam berdarah belum ditemukan, maka itu pencegahan jauh lebih penting. Para peneliti telah merekomendasikan vaksin aman berbasis nonstructural protein 1 (NS1) karena sifat imunogeniknya. Mereka telah mengidentifikasi empat epitope di NS1 yang diduga bereaksi kuat dengan epitope B cells, yaitu LD2, 24A, LX1, 24C. Tujuan dari riset ini adalah untuk menganalisa dan membandingkan strain DENV-4 yang diisolasi di Jakarta 2010 dengan 34 strain DENV-4 lainnya yang didapat dari GenBank menggunakan UGENE software sebagai basis dari pengembangan vaksin. Penelitian ini menggunakan data sekunder berupa urutan nukelotida virus dengue serotipe 4 strain IDSS44/10 yang diamplifikasi dan diurutkan di Departemen Mikrobiologi, FKUI. Dari hasil penelitian ini dapat disimpulkan bahwa gen NS1 dari DENV-4 strain IDSS44/10 dapat digunakan sebagai kandidat vaksin dengue di masa mendatang. Hasil menunjukkan bahwa epitope 24C menunjukkan motif yang homolog di setiap sekuens asam amino pada NS1 DENV-4. Hampir seluruh DENV-4 strain yang diisolasi termasuk IDSS44/2010 memiliki urutan asam amino yang sama pada epitop LD2, 24A, LX1, 24C.

---

Dengue hemorrhagic fever has become a worldwide issue. Heterologous infection by different serotypes may lead to this advanced stage of dengue infection and even death. Dengue virus serotype 4 has been reported to cause more severe secondary infection compared to other serotypes. To date, there is no specific treatment for this disease therefore prevention is much more important.

Researchers have proposed a safe vaccine strategy that is based on nonstructural protein 1 (NS1) as it is strongly immunogenic. They identified four epitopes on NS1 that reacted strongly to B cell epitopes which are LD2, 24A, LX1, and 24C. The goal of this research is to identify and compare these NS1 epitopes among DENV-4isolated in Indonesia 2010 with other DENV-4 strains using UGENE softwareas a base of vaccine development. This study used a nucleotide sequence data of DENV-4 strain IDSS44/10 that was amplified and sequenced in Microbiology Department, FKUI.

The results show that NS1 gene DENV-4, IDSS44/2010 strain could be used as a dengue vaccine candidate in the future.The results show that 24C epitope was highly conserved among 35 DENV-4 NS1 sequences. Most of the DENV-4 including IDSS44/10 Indonesian strain have similar amino acids sequences on the epitopes (LD2, 24A, LX1, and 24C)."