Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 95565 dokumen yang sesuai dengan query
cover
Lenggo Geni
"[ABSTRAK
Demam berdarah dengue (DBD) merupakan penyakit yang disebabkan karena
infeksi virus dengue (DENV), yang banyak ditemukan di Indonesia. Belum ada
terapi yang spesifik dalam pengobatan DBD. Upaya pengembangan vaksin
dengue yang efektif sangat diperlukan. Pada penelitian ini dilakukan analisa
imunogenisitas kandidat vaksin DNA prM-E dengue serotipe 2 (pUMD2.kl.20)
dengan menganalisis sel T CD4, sel T CD8, IFN-γ dan TNF-α. pada sel U937 dan
PBMC secara in vitro, bertujuan untuk mengetahui respon imun ketika vaksin
diinjeksikan ke dalam tubuh manusia. Dasar penelitian ini adalah sel U937
ditransfeksi dengan pUMD2.kl.20 menggunakan lipofectamin. Sel U937 akan
berperan sebagai APCs yang akan mengekspresikan protein prM-E DENV-2 dan
mempresentasikan protein tersebut melalui molekul MHC class I dan MHC class
II kepada Peripheral Blood Mononuclear Cell (PBMC) manusia. Tahapan kerja
yang dilakukan dalam penelitian ini terdiri dari: (a) kultur galur sel U937, (b)
transfeksi sel U937 dengan pUMD2.kl.20, (c) transfeksi sel U937 dengan plasmid
s(pUMVC), (d) infeksi sel U937 dengan DENV-2 strain DS.18/09, (e) pewarnaan
dan pengamatan hasil pewarnaan menggunakan alat semi flowcytometri (TALI).
pUMD2.kl.20 mengaktivasi sel T CD4 dan sel T CD8 untuk berploriferasi. Hasil
penelitian ini menunjukkan bahwa konsentrasi sel T CD8 lebih tinggi dari
konsentrasi sel T CD4 dan konsentrasi sel positif yang mensekresikan IFNγ lebih
tinggi dari konsentrasi sel positif yang mensekresikan TNFα. Kondisi optimal dari
aktivasi sel T CD4 oleh pUMD2.kl.20 adalah 24 jam setelah penambahan PBMC
setelah transfeksi (8,53x10⁴sel/ml), untuk sel T CD8 adalah 24 jam setelah
penambahan PBMC setelah transfeksi (49,4x10⁴ sel/ml). Kondisi optimal dari
aktivasi sel+ yang mensekresikan IFNγ oleh pUMD2.kl.20 adalah 24 jam setelah
penambahan PBMC 48 jam setelah transfeksi (9,86x10⁴ sel/ml), dan untuk sel+
yang mensekresikan TNFα adalah 2 jam setelah penambahan PBMC 48 jam
setelah transfeksi (2,1x10⁴ sel/ml). Dari penelitian ini dapat disimpulkan bahwa
pUMD2.kl.20 bersifat imunogenik.

ABSTRACT
Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic, Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic]"
2015
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Lola Febriana Dewi
"ABSTRAK
Infeksi yang disebabkan oleh virus dengue telah banyak dilaporkan di negara tropis dan subtropis. Virus dengue terdiri dari 4 serotipe yaitu dengue 1-4. Hingga saat ini belum tersedia vaksin yang berlisensi untuk mencegah terjadinya infeksi dengue. Pada penelitian ini dikonstruksi vaksin DNA yang mengkode gen prM-E dan prM-E-NS1del virus dengue 2 strain Indonesia yang akan dijadikan sebagai kandidat vaksin dengue. Hasil penelitian berhasil mendapatkan 9 plasmid rekombinan pUMDE2 yang membawa gen sisipan prM-E dan telah dikonfirmasi dengan melakukan PCR koloni dan restriksi plasmid. Dari hasil sekuensing plasmid pUMDE2 koloni no. 11 ditemukan 19 mutasi asam amino pada gen prM-E, sepuluh mutasi pada gen prM dan sembilan mutasi pada gen E. Mutasi protein prM N29D dan N52K serta protein E V164I dan S390N terletak pada daerah epitop pengenalan sel B. Transfeksi plasmid pUMDE2 dilakukan pada sel Chinese Hamster Ovary (CHO)-K1 dan menunjukkan adanya ekspresi protein prM-E rekombinan berdasarkan uji imunostaining dan ELISA. Hasil ELISA menunjukkan bahwa protein ditemukan pada sel yang ditransfeksi. Sedangkan, plasmid rekombinan yang membawa gen prM-E-NS1del tidak berhasil dikonstruksi. Plasmid pUMDE2 dapat dikembangkan menjadi kandidat vaksin DNA.

ABSTRACT
Infection by dengue virus were reported in tropical and subtropical area. Dengue virus (DENV) consist of 4 serotype, DENV-1 to DENV-4. There is no licensed vaccine available for dengue infection. In this research, we construct DNA vaccine encode prM-E and prM-E-NS1del genes of dengue virus serotype 2 for vaccine development. Nine recombinant plasmids that encode prM-E genes (pUMDE2), were successfully obtained. Recombinant plasmids were confirmed by PCR colony and restriction enzyme analysis. Colony of pUMDE2 no. 11 was sequenced and total 19 amino acid mutations were founds, 10 mutations in prM and 9 mutations in E protein. prM mutations N29D and N52K, E mutations of V164I and S390N were found in B cell epitopes. Transfection pUMDE2 plasmid was done to Chineese Hamster Ovary (CHO)-K1 and showed that recombinant protein prM-E was successfully expressed by immunostaining assay and ELISA. Results showed that the protein was mainly found in cell fraction. However, recombinant plasmid that encode prM-E-NS1del were failed to be constructed. pUMDE2 could be developed for vaccine candidate.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2016
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Akhmadzhon Fakhriddinov
"Demam Dengue (DD) dan Demam Berdarah Dengue (DBD) adalah penyakit yang tersebar luas. Penelitian ini dilakukan untuk mengembangkan kandidat vaksin dengue nasional berbasis protein sub unit prM/E DEN-4. Protein prM/E adalah kompleks unik yang berperan penting dalam perakitan virus dan modulasi fusi. Penelitian telah dilakukan dengan metode Gateway cloning system untuk menklon gen prM/E dalam plasmid cloning pDONR221 kemudian dilakukan subkloning dan dipindahkan gen prM/E ke dalam plasmid eksperesi pET-55-DEST. Ekspresi protein prM/E dilakukan di dalam E.coli BL21 (DE3) dengan induksi Isoprophyl-β-D-thiogalactopyranoside (IPTG). Pendeteksian poliprotein Gag hasil ekspresi dilakukan dengan metode Sodium Dodecyl Sulphate Polyacrilamide Gel Electrophoresis (SDS-PAGE). Setelah protein prM/E berhasil dideteksi kemudian protein prM/E dipurifikasi dengan menggunakan metode immobilized metal affinity chromatography (IMAC) di bawah kondisi denaturasi. Hasil penelitian yaitu protein prM/E dapat diekspresikan dalam E.coli BL21 (DE3) dengan berat molekul ~75 kDa.

Dengue Fever is an infectious disease caused by one of the four serotypes of dengue virus (DENV). Until now, no licensed vaccines or antivirus is available commercially. Because of that, this research was aimed to develop candidate vaccine dengue based on protein subunit pre-membrane and Envelope (prM/E). Protein prM/E is a unique complex which has important role in virus assembly
and host cell entry. The recombinant protein development was done using Gateway cloning system. This was used to clone the prM/E gene into pDONR221 plasmid. The cloned gene was then transferred into pET-55-DEST expression plasmid. Expression of protein prM/E was perfomed in E. coli BL21 (DE3) with inducer Isoprophyl-β-D-thiogalactopyranoside (IPTG). Sodium Dodecyl Sulphate Polyacrilamide Gel Electrophoresis (SDS-PAGE) method was used to detect the expressed prM/E protein. Upon detection of prM/E protein with SDS-PAGE, the recombinant protein was purified by using immobilized metal affinity chromatography (IMAC) method under denature condition. Using these methods, the prM/E protein was successfully expressed in E.coli BL21 (DE3) with a molecular weight ~75 kDa."
Universitas Indonesia, 2016
S62059
UI - Skripsi Membership  Universitas Indonesia Library
cover
Amry Irsyada Yusuf
"Kasus demam berdarah dengue DBD masih menjadi salah satu masalah kesehatan di dunia dan di Indonesia dengan tingginya angka kematian yang diakibatkan. Sampai saat ini belum terdapat terapi antiviral spesifik, sehingga terapi masih berupa suportif. Ekstrak daun Cynometra ramiflora Linn diketahui memiliki efek bakterisida, analgesik, antiviral, anti-inflamasi, dan anti-alergi. Kemampuan ekstrak daun Cynometra ramiflora Linn pada konsentrasi 20 ?g/ml , 10 ?g/ml, 5 ?g/ml, 2,5 ?g/ml, dan 1,25 ?g/ml sebagai anti-dengue virus DENV diujikan pada sistem in-vitro menggunakan sel Huh-7.5 terinfeksi DENV2 dengan multiplicity of infection moi 0,5. Kontrol positif dalam penelitian ini adalah sel Huh-7.5 yang terinfeksi DENV2, sel Huh-7.5 dengan pemberian pelarut dimethyl sulfoxide DMSO sebagai kontrol negaitf dan kontrol sel Huh-7.5 tanpa perlakuan, dengan enam ulangan pada setiap kelompok.. Efek hambat ekstrak terhadap replikasi DENV dinilai menggunakan metode foci-forming immunoassay. Secara statistik pemberian ekstrak daun Cynometra ramiflora Linn pada seluruh konsentrasi menunjukkan penghambatan signifikan terhadap replikasi DENV-2 p < 0,05 dibandingkan dengan kontrol positif. Tingkat penghambatan berturut-turut sebesar 36,06 , 45,96 , 47,35 , 55,94 , 62,70 pada konsentrasi 1,25 ?g/ml, 2,5 ?g/ml, 5 ?g/ml, 10 ?g/ml, dan 20 ?g/ml. Hasil penelitian ini menunjukkan ekstrak daun Cynometra ramiflora Linn berpotensi sebagai antiviral dengue.

Dengue hemorraghic fever DHF remains a major health problem of world particularly in Indonesia due to high moratlity rate of it. Until now, there is no specific antiviral therapy for DENV yet and the treatment is still supportive. The extract of Cynometra ramiflora Linn leaves known to have some effects such as bactericide, analgesic, antiviral, anti inflamation, and anti allergy. The potency Cynometra ramiflora Linn leaves extract at concentration of 1,25 g ml, 2,5 g ml, 5 g ml, 10 g ml, dan 20 g ml as anti viral dengue DENV was performed in vitro on Huh 7.5 cell infected by DENV 2 with MOI 0.5. Positive control in this research was Huh 7.5 cell infected by DENV 2, group of Huh 7.5 with dimethyl sulfoxide DMSO as negative control, and group of Huh 7.5 cell only as cell control. Each group was done in six repetition. The inhibition rate of the extract to DENV replication was measured using foci forming immunoassay. Statistically administration Cynometra ramiflora Linn leaves extract showed significant inhibition at each concentration p 0,05 compared with positive control. The inhibition rate were 36,06 , 45,96 , 47,35 , 55,94 , 62,70 at concentration of 1,25 g ml, 2,5 g ml, 5 g ml, 10 g ml, dan 20 g ml respectively. The result of this study showed that extract of Cynometra ramiflora Linn leaves has potency as antiviral dengue."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2016
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Marsandi Nugraprawira Mardjoeki
"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Alesia Prillya Mauna
"Infeksi dengue merupakan masalah kesehatan di dunia, termasuk Indonesia. Di Indonesia, kasus terjadinya infeksi terus bertambah dari tahun 1968 sampai 2015. Meskipun demikian, sampai sekarang masih belum ada pengobatan yang efektif terhadap DENV. Penelitian bertujuan untuk mengevaluasi potensi katekin sebagai antivirus, yang dapat digunakan dikemudian hari untuk menjadi dasar obat antivirus. Penelitian terbaru menunjukkan bahwa katekin adalah kandidat antivirus DENV yang bagus, terutama terhadap dengue serotipe DENV-1, DENV-2, dan DENV4 dengan menempel pada NS4B. NS4B itu sendiri penting untuk proses replikasi virus. Akan tetapi, riset ini dilakukan pada tahap molecular docking. Riset ini merupakan riset eksperimental untuk mengetahui potensi katekin sebagai antivirus terhadap DENV serotipe 2 NGC pada sel Huh7it-1. Untuk mengetahui potensi katekin, indeks selektivitas harus diketahui dengan cara mengetahui nilai CC50 dan IC50 dari katekin. CC50 adalah konsentrasi katekin yang dapat merusak setengah dari total sel, yang bisa didapat melalui metode MTT Assay. Sedangkan IC50 adalah konsentrasi dari katekin yang dapat menginhibisi setengah dari total virus, yang bisa didapat melalui metode Focus Assay. Hasil riset ini menemukan CC50 dari katekin adalah 2.755,091 μg/mL, sedangkan IC50nya adalah 21,457 μg/mL. Indeks Selektivitas adalah rasio dari CC50 dan IC50, sehingga Indeks Selektivitas nya adalah 128,400 dengan demikian, katekin berpotensi untuk dikembangkan sebagai antivirus dimasa mendatang.

Dengue infection is a health issue worldwide. In Indonesia, the rate of infection increased since 1968 to 2015. However, there is still no effective cure against DENV infection until today. Research aims to evaluate catechin’s potency as an antivirus, that can be used in the future as a basis for antiviral drug. Recent research proved that catechin can be a good candidate for antivirus against DENV, especially DENV-1, DENV-2 and DENV-4 serotype by binding to NS4B. NS4B itself is important for viral replication. However, this research was still in the molecular docking stage. This research is an experimental research to seek the potency of catechin as antiviral using DENV Serotype 2 Strain NGC in Huh7it-1 cell. To determine the potency, selectivity index value is needed by achieving the value of CC50 and IC50 of catechin. CC50 is the concentration of catechin that is harmful for the 50% of the viable cells, which its value can be obtained from MTT Assay method. Meanwhile, IC50 is defined as the concentration of catechin that can inhibit 50% of the total virus, which its value can be obtained from of Focus Assay method. This research result found that the CC50 of catechin is 2,755.091 μg/mL and IC50 is 21.457 μg/mL. SI is the ratio between CC50 and IC50, therefore the SI was 128.400. Thus, catechin has the potency to be developed as an antivirus in the future."
Jakarta: Fakultas Kedokteran Universitas Indonesia , 2019
S-pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Yora Permata Dewi
"Infeksi DENV masih menjadi masalah kesehatan masyarakat di Indonesia karena dapat menyebabkan penyakit berat dan bahkan mungkin berakibat fatal. Pengembangan vaksin rekombinan dengan antigen yang mampu dengan efektif menginduksi respon imun perlu untuk dikembangkan. Kesesuaian genotipe yang digunakan di vaksin dan genotipe yang beredar di suatu wilayah berimplikasi terhadap keberhasilan pengembangan vaksin. Plasmid rekombinan yang dirancang berdasarkan gen prM-E DENV-2 strain 151 diekspresikan di Pichia pastoris strain X-33. Telah dilakukan optimasi ekspresi dan antigenisitas protein rekombinan prM-E. Diperoleh 4 koloni P. pastoris rekombinan dengan fenotipe Mut . Hasil SDS-PAGE dan Western blot menunjukkan protein telah berhasil diekspresikan pada ukuran 50 kDa. Kondisi ekspresi optimum protein rekombinan prM-E DENV-2 yaitu pada konsentrasi metanol 1 dengan waktu inkubasi 48 jam. Protein rekombinan prM-E DENV-2 dikenali oleh antibodi anti- prM-E DENV-2 dan bereaksi silang dengan antibodi anti-prM-E DENV-1, DENV-3, serta DENV-4. Protein rekombinan prM-E DENV-2 yang diperoleh dapat digunakan sebagai antigen dalam pengembangan vaksin protein rekombinan dengue strain Indonesia.

DENV infection is still a public health problem in Indonesia because it can cause severe illness and may even be fatal. Development of recombinant vaccine with antigens capable of effectively inducing an immune response needs to be developed. The suitability of genotypes used in vaccines and genotypes circulating in a region has implications for the successful development of vaccines. Construction of a recombinant plasmid based on prM E gene of DENV 2 strain 151 was used for expression in Pichia pastoris strain X 33. Optimization and antigenicity of DENV 2 prM E recombinant protein were tested. Four Mut phenotypes were generated. SDS PAGE and Western blot analysis showed that the protein was expressed with a molecular weight of 50 kDa. Optimal protein expression level occurred at concentration of 1 methanol with 48 hours incubation time. DENV 2 prM E recombinant protein was recognized by anti prM E DENV 2 and also showed cross reaction with anti prM E DENV 1, DENV 3, and DENV 4 antibodies. Thus, the DENV 2 prM E recombinant protein can be used as an antigen in the development of the recombinant protein vaccine of the dengue strains of Indonesia. "
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2017
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Leonardus Wibowo Hidayat
"ABSTRAK
Penelitian terkait karakteristik genetik sekuens virus dengue (DENV) diperlukan dalam menilai kekerabatan antara strain DENV yang tersebar di seluruh dunia. Tujuan dalam penelitian ini adalah membandingkan karakteristik genotype dan sekuens data DENV serotipe 2 (DENV-2) nukleotida envelope dibandingkan dengan sekuens data DENV-2 nukleotida Non-Struktural 1 (NS1). Data didapatkan dari Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia untuk strain data yang berasal dari Indonesia dan GenBank untuk strain data yang berasal dari seluruh dunia sebagai data pembanding dengan jumlah sebanyak 42 data, yang kemudian dianalisis menggunakan Genetyx 5.1. Hasil penelitian didapatkan bahwa sekuens data NS1 strain DENV-2 yang berasal dari Indonesia termasuk ke dalam kelompok genotype Cosmopolitan, serupa dengan hasil analisis data dengan sekuens data envelope strain DENV-2. Sementara pada analisis epitope LX1 yang merupakan epitope khas dari NS1, terdapat berbagai peubahan komponen asam amino pada epitope tersebut dibandingkan dengan sekuens data strain Indonesia yang tergabung ke dalam kelompok genotype Cosmopolitan. Kesimpulan dari penelitian ini adalah bahwa filogenetik dengan menggunakan NS1 sebagai bahan analisis dapat digunakan untuk menentukan genotipe. Sehingga gen NS1 pada DENV-2 strain Indonesia masih dapat dipertimbangkan sebagai salah satu dasar metode pengembangan vaksin.

ABSTRACT
Studies about genetic characteristic between dengue virus serotype 2 (DENV-2) sequence data is needed to determine its relationship between DENV strain over the world. The main purpose of this study is to compare between characteristic of sequence data DENV-2 envelope nucleotide and sequence data DENV-2 Non- Structural 1 (NS1) nucleotide, and analyze between amino acid homology in this study and related previous studies. 42 data used for this study are obtained from Laboratory of Microbiology Faculty of Medicine University of Indonesia for data from Indonesia and form GenBank for data from other countries as a comparison, which is analyzed with software Genetyx 5.1. NS1 sequence data from DENV-2 strain from Indonesia is classified in Cosmpolitan genotype group, which are similar than data analysis from envelope sequence data from same data. Meanwhile in analysis of LX1 epitope, which is considered as typical epitope from NS1, there are any differences in amino acid component at it compared than strain Indonesia data sequences which are included in Cosmopolitan genotype group. As a conclusion, phylogenetic analysis of NS1 nucleotide is useful for determining the genotypes, which means NS1 DENV-2 gene strain Indonesia can be useful as the basis for vaccine development"
2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Muhammad Arif Sanusi
"Infeksi dengue masih merupakan masalah kesehatan di Indonesia sebagai negara endemik. Sampai saat ini, belum ditemukan terapi definitif sebagai tatalaksana infeksi dengue. Penelitian untuk pengembangan antivirus dengue sudah banyak dilakukan. Ekstrak Calophyllum canum, sebagai salah satu tanaman yang tumbuh di Kalimantan, ditemukan memiliki efek anti mikroganisme. Penelitian dilakukan untuk menguji efek antiviral dari crude extract batang C. canum fraksti etil asetat terhadap replikasi virus dengue serotipe-2 (DENV-2) pada sel Huh7it-1 dengan focus assay dan MTT assay untuk menguji sitotoksitas pada sel tidak terinfeksi. Nilai IC50 dari ekstrak C. canum pada sel Huh7it-1 adalah 123,96 μg/mL dan nilai CC50 adalah 620,57 μg/mL. Indeks selektivitas adalah 5,01. Pada focus assay terdapat perbedaan bermakna antara tiap perlakuan dengan kontrol (p<0,001) namun pada MTT assay tidak terdapat perbedaan bermakna antara tiap perlakuan dengan kontrol (p≥0,05). Crude extract dari batang C. canum memiliki efek inhibisi terhadap replikasi DENV-2 secara in Vitro pada sel Huh7it-1.

Until now, dengue infection is still a health concern in Indonesia. There is no definite treatment for dengue infection. The development of dengue antivirus using natural extract of plant have been conducted. Calophyllum canum, a plant that grow in Kalimantan was discovered to have anti-microorganism effect. In present study, crude extract of C. canum stem in ethyl acetate fraction was used to examine the antiviral effect on dengue virus seroptype-2 (DENV-2) replication on Huh7it-1. The inhibition of DENV-2 replication was determined by focus assay. The cytotoxicity of uninfected cells by MTT assay. The IC50 value of C. canum on Huh7it-1 cells was 123.96 μg/mL and the CC50 value was 620.57 μg/mL. The selectivity index was 5.01. There was significant difference on focus assay between all concentration with control (p<0.001), but there was no significant difference in MTT assay (p≥0.05). Crude extract of C. canum stem showed inhibition effect on DENV-2 replication in vitro on Huh7it-1 cells.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Shirley Ratnasari
"ABSTRACT
Latar Belakang: Penyakit demam dengue telah menjadi sebuah isu kesehatan yang mencemaskan di seluruh dunia, terutama di negara-negara berkembang layaknya Indonesia. Sampai saat ini, masih belum ditemukan antivirus yang efektif untuk membasmi virus dengue 1-4 DENV 1-4 . Ekstrak daun Cassia alata telah dikenal karena bahan-bahan dasarnya yang memiliki potensi sebagai antivirus.Tujuan: Penelitian ini dilakukan untuk meneliti efek ekstrak daun Cassia alata terhadap replikasi DENV-2.Metode: Ekstrak Cassia alata dengan beberapa konsentrasi yang berbeda 320 ?g/mL, 160 ?g/mL, 80 ?g/mL, 40 ?g/mL, 20 ?g/mL, dan 10 ?g/mL dengan DMSO 0.1 sebagai kontrol negatif diujikan kepada sel Huh7 yang telah diinfeksi DENV-2 untuk meneliti kemampuan antiviralnya terhadap sel. Viabilitas sel akan dinilai dengan menggunakan MTT assay. Sedangkan persentasi inhibisi virus dievaluasi menggunakan Focus assay dengan melalui prosedur immunostaining.Hasil: Ekstrak Cassia alata pada sel Huh-7 memiliki nilai CC50 32,3 terhadap DENV-2.Kesimpulan : Ekstrak daun Cassia alata terbukti memiliki aktivitas antiviral yang sangat poten ketika diujikan terhadap DENV-2.

ABSTRACT
Background Dengue fever has been causing health related issues and distress all around the world, especially in developing countries such as Indonesia. Up to date, there has yet to be an effective antiviral to eliminate Dengue Virus Serotype 2 DENV 2 . Cassia alata leaves extract are known for its rich compounds that are thought to be beneficial as an antiviral.Aim This research is done to evaluate effects of Cassia alata leaf extracts on the replication of dengue virus serotype 2.Methods The Cassia alata extracts were tested upon Huh7 cells that are infected with DENV 2 and various concentrations of the extract 320 g mL, 160 g mL, 80 g mL, 40 g mL, 20 g mL, and 10 g mL were given to treat the cells, with DMSO 0.1 as a negative control. Cell viability was assessed using MTT Assay and the viral inhibition was evaluated using Focus Assay, through immunostaining procedure.Result The extract on Huh 7 cells had a CC50 of "
2016
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>