Hasil Pencarian  ::  Simpan CSV :: Kembali

"ABSTRAKUntuk menciptakan penutupan sistem saluran akar yang adekuat diperlukan bahan siler yang berfungsi untuk mengisi celah diantara gutaperca dan dinding saluran akar.Pada pengisian saluran akar sering ditemukan kondisi siler yang keluar dari foramen sehingga berkontak dengan jaringan periapeks dalam waktu yang berkepanjangan.Untuk itu, salah satu persyaratan dari bahan siler saluran akar adalah harus bersifat biokompatibel terhadap jaringan periradikular.Genotoksisitas adalah salah satu faktor penting yang mempengaruhi biokompatibilitas bahan. Siler saluran akar yang digunakan saat ini merupakan bahan kimia yang dapat mengakibatkan kerusakan pada DNA apabila terpapar dalam waktu yang lama.Terdapat berbagai macam bahan siler seperti siler berbasis Resin, Silikon, atau Bioceramik yang masing-masing memiliki kandungan zat yang berpotensi genotoksik. Tujuan penelitian ini adalah untuk mengetahui dan membandingkan potensi genotoksisitas pada siler berbasis Resin, Silikon, dan Bioceramik terhadap DNA sel limfosit manusia dengan menggunakan uji genotoksisitas ?-H2AX selama 1, 3 dan 7 hari. Berdasarkan hasil penelitian diketahui bahwasiler berbasis Resin, Silikon, dan Bioceramik memiliki potensi genotoksik terhadap DNA sel limfosit manusia dengan nilai tertinggi terdapat pada siler berbasis resin, selanjutnya diikuti oleh siler berbasis Silikon dan Bioceramik.

---

ABSTRACTTo create an adequate sealing on root canal system, it is requires a sealer that fill the gap between gutta percha and root canal wall. In root canal obturation, it is frequently found that sealer leak to foramen and in contact with periapex tissue in a prolonged time. For that reason, one property that requirement of root canal sealer material is biocompatible to periradicular tissue. Genotoxicity is one of the important factors that affecting the biocompatibility of the material. Root canal sealer used today are chemicals that can cause DNA damage when exposed for long periods of time. There are a wide range of sealers such as Resin based sealer, Silicone based, or Biaceramic based that each have a potentially genotoxic substance. The purpose of this study was to investigate and compare the potential genotoxicity of Resin based Silicone based, and Bioceramic based sealers against human DNA lymphocytes using H2AX assay for 1, 3, and 7 days. Based on the results, it is known that Resin based, Silicone based, and Bioceramic based sealers have genotoxic potential against human DNA lymphocytes with the highest value found in Resin based, followed by Silicone based and Bioceramic based sealers."

"Kuskus (Phalangerids) adalah marsupial endemik yang distribusinya di wilayah Indonesia Timur. Populasi kuskus di Indonesia cenderung menurun. Hal ini karena aktivitas manusia seperti penebangan pohon yang illegal, perburuan yang berlebihan dan perusakan habitat. Tujuan dari penelitian ini untuk mengidentifikasi genetika cuscus berdasarkan pada gen subunit 1 sitokrom c oksidase dan melakukan analisis pohon filogeni. Gen sitokrom c oksidase subunit I dari DNA mitokondria dianalisis menggunakan PCR. Hasil sekuensing dianalisis menggunakan MEGA 7. Rekonstruksi pohon filogenetik dibuat menggunakan metode Neighbor-joining sedangkan analisis jarak genetik menggunakan metode Kimura. Hasil penelitian menunjukkan bahwa sampel cuscus dari pulau Halmahera berada satu clade dengan Phalanger sp. dan sampel dari Pulau Seram berada satu clade dengan Spilocuscus sp. Cuscus (Phalanger ornatus) adalah salah satu marsupial endemik yang dilindungi oleh pemerintah. Di Indonesia, habitat P.ornatus ditemukan di hutan primer dan sekunder di Pulau Halmahera. Penelitian ini bertujuan untuk mengidentifikasi karakteristik habitat, jenis pakan, dan pohon sarang P.ornatus di Pulau Halmahera. Penelitian ini dilakukan 2 bulan dari Mei hingga Juni 2016. Karakteristik habitat diidentifikasi menggunakan analisis vegetasi, sedangkan jenis pakan dan spesies pohon sarang diidentifikasi dengan pengamatan langsung dan tidak langsung. Indeks nilai penting tingkat pohon tertinggi, Ficus sp. dan Dracontomelon dao. Pada habitat P.ornatus, terdapat 42 spesies tanaman yang dimanfaatkan oleh P.ornatus. Persentase tertinggi bagian tanaman yang dimakan oleh P.ornatus, berturut-turut adalah buah (55,36%) dan daun muda (35,72%), bunga (7,14%), dan pucuk (1,79%). Hampir semua pohon yang digunakan sebagai tempat bersarang oleh P.ornatus juga merupakan pohon yang menjadi pakan. Pohon yang menjadi sarang P.ornatus terdiri atas 9 spesies, yaitu Buchanania arborescens, Barringtonia asiatica, Palaquium obovatum, Dracontomelon dao, Cocos nucifera, Ficus sp., Ficus virens, dan Pandanus sp. Komunitas suku Tobelo Dalam yang tinggal di desa Saolat, distrik Wasile Selatan memiliki kebiasaan melakukan aktivitas perburuan hewan di hutan-hutan sekitar desa, termasuk perburuan kuskus untuk tujuan penjualan dan konsumsi. Penelitian ini bertujuan untuk mendeskripsikan pengetahuan tradisional masyarakat Tobelo Dalam di desa Saolat dalam menerapkan sistem pemanfaatan dan pengetahuan konservasi lokal terhadap kuskus. Penelitian ini dianalisis dengan metode kualitatif menggunakan teknik survei eksploratif, wawancara, dan pengisian kuesioner. Penelitian ini menggunakan 4 informan kunci (3 pria, 1 wanita) dan 50 responden dewasa (25 pria dan 25 wanita). Hasil kuesioner menunjukkan bahwa skor rata-rata pengetahuan dasar tentang karakteristik kehidupan kuskus, yang diperoleh oleh responden laki-laki adalah 9,93 dan responden perempuan adalah 6,42, sedangkan untuk pengetahuan konservasi kuskus, skor rata-rata yang diperoleh oleh responden laki-laki adalah 18 dan responden wanita 10.77. Ini menunjukkan bahwa pengetahuan yang dimiliki laki-laki tentang kuskus lebih dari pengetahuan perempuan. Komunitas suku Tobelo Dalam berburu kuskus untuk empat tujuan yang berbeda, yaitu, untuk upacara tradisional, obat tradisional, masakan, dan menjualnya untuk mendapatkan lebih banyak pendapatan untuk mendukung ekonomi keluarga.

---

Cuscuses (Phalangerids) are the endemic marsupial distributed in eastern Indonesia. Population cuscus in Indonesia is decrease. It due to current human activities such as land use changes, excessive hunting and habitat destruction lead to a declining population of cuscus. The aim of this study was to identify the genetics of cuscus based on the cytochrome c oxidase subunit 1 gene and phylogeny tree analysis. The cytochrome c oxidase subunit I gene of mitochondrial DNA was analyzed using PCR. Genetic analysis results were analyzed using MEGA 7. Reconstruction of phylogenetic trees used the Neighbor-joining method while pairwise distance analysis used Kimura method. The results showed that cuscuses samples from Halmahera island are shown one clade with Phalanger sp. and from Seram Island is one clade with Spilocuscus sp. Cuscus (Phalanger ornatus) is one of the endemic protected marsupials. In Indonesia, the ornatus cuscus habitats found in primary and secondary forests on Halmahera Island. This study aims to identify habitat characteristics, types of feed, and nest trees on Halmahera Island. This research was conducted 2 months from May to June 2016. Characteristics of habitat were identified using vegetation analysis, while feed types and nest tree species were identified by direct and indirect observations. The highest tree-level important value index, Ficus sp. and Dracontomelon dao. In the cuscus ornatus habitat, are 42 species of plants which are recorded cuscus ornatus. The highest percentage of plant parts eaten by cuscus ornatus is fruit (55,36%) and young leaves (35,72%), flowers (7,14%), and shoots (1,79%) respectivelly. Almost all the trees used as nesting places by cuscus ornatus is also feed trees, which consist of 8 species, namely Buchanania arborescens, Barringtonia asiatica, Palaquium obovatum, Dracontomelon dao, Cocos nucifera, Ficus sp., Ficus virens, and Pandanus sp. The Tobelo Dalam tribal community who live in Saolat village, district South Wasile provokes the high activity of animal poaching in forests around the village, including cuscus hunting for both sale and consumption purposes. The study aimed to describe the traditional knowledge of Tobelo Dalam people in Saolat village in applying the systems of utilization and local conservation knowledge towards cuscus. This study was analyzed by the qualitative method with explorative survey technique, interview, and completing questionnaires. This study used 4 key informants (3 males, 1 female) and 50 adult respondents (25 males and 25 females). The questionnaire results showed that the average score of basic knowledge about the life characteristics of cuscus, obtained by male respondents was 9,93 and female respondents were 6,42, whereas for knowledge of cuscus conservation, the average score obtained by male respondents was 18 and female respondents 10,77. This indicates that the knowledge that male have about cuscus is more than that of female. The community of Tobelo Dalam tribe hunts cuscus for four different purposes, i.e., for traditional ceremonies, traditional medicine, cuisine, and sell it for more income to support the economy of family."

"ABSTRAKKanker merupakan penyakit yang dapat menyerang berbagai organ tubuhsehingga berisiko mematikan. Kurangnya informasi dan metode untuk mendeteksirisiko kanker secara dini menjadi salah satu penyebab meningkatnya angkakejadian dan kematian akibat kanker di dunia. Oleh karena itu, berbagai metodesedang dikembangkan untuk mendeteksi risiko kanker secara dini, salah satunyadengan identifikasi biomarker kerusakan DNA berupa DNA adduct. Padapenelitian ini dianalisis 8-OHdG, yaitu adduct dari basa guanin yang mengalamiserangan spesies reaktif pada posisi C-8. Analisis kuantitatif konsentrasi 8-OHdGdalam sampel dilakukan menggunakan instrumen HPLC-UV pada panjanggelombang 254 nm dengan komposisi eluen metanol : buffer fosfat 20:80.Sembilan orang penderita kanker payudara (CA) dan 17 orang perokok (SP)dipilih sebagai sampel pada penelitian ini. Sebagai kontrol, diambil 31 sampel nonperokok (NK). Pada sampel kelompok CA, SP, dan NK terdeteksi 8-OHdGmasing-masing sebesar 0,913 ? 124,171 mg 8-OHdG/g kreatinin, 4,121 - 66,731mg 8-OHdG/g kreatinin, dan 0,035 - 47,493 mg 8-OHdG/g kreatinin. Hasilanalisis dan uji statistik menunjukkan bahwa sampel penderita kanker payudaramemiliki konsentrasi 8-OHdG yang lebih tinggi daripada sampel perokok dansampel kontrol. Konsentrasi 8-OHdG dapat menggambarkan tingkat kerusakan oksidatif DNA

---

ABSTRACTCancer is a disease that can affect various organs of the body so that it

may cause the risk of lethal. Lack of information and methods for early detection

of cancer risk is one cause of increasing incidence of and mortality from cancer in

the world. Therefore, various methods are being developed for early detection of

cancer risk, one methods is with the identification of biomarkers of DNA damage

in the form of DNA adducts. In this study, 8-OHdG was analyzed, which is the

guanine base adducts of the reactive species atatck at C-8 position. Quantitative

analysis of 8-OHdG concentration in the sample was carried out using HPLC-UV

instrument at a wavelength of 254 nm with eluen composition of methanol :

phosphate buffer 20:80. Nine people with breast cancer (CA) and 17 smokers (SP)

was chosen as the sample in this study. As a control, 31 samples of non-smokers

was taken. On a sample group of CA, SP, and NK, 8-OHdG were detected

respectively by 0,913 ? 124,171 mg 8-OHdG/g creatinine, 4,121 - 66,731 mg 8-

OHdG/g creatinine, dan 0,035 - 47,493 mg 8-OHdG/g creatinine. Analysis and

statistical result indicate that breast cancer samples have higher concentrations of

8-OHdG than the control samples and samples of smokers. 8-OHdG

concentrations may reflect the level of oxidative DNA damage."

"Ruang lingkup dan cara penelitian : AFP adalah protein onkofetal yang disintesis pada masa fetus dan ekspresinya ditekan pada. individu dewasa sehat. Kadar AFP ini akan meningkat kembali pada penderita keganasan hati. Telah diketahui bahwa ekspresi gen APP diakhir pada tingkat transkripsi, akan tetapi, mekanisme pengaturan dari faktor yang mendukung proses pengaturan sintesis AFP tersebut masih belum pasti. Oleh karena itu penelitian ini bertujuan untuk mengisolasi (ragmen DNA yang mengandung elemen promotor gen dan gen penyandi AFP. Fragmen DNA ini selanjutnya akan digunakan dalam penelitian ekspresi gen APP secara in vitro secara efisien. DNA AFP bahan uji yang digunakan adalah bersumber dari sel jaringan hati tikus Rattus navergic's strain Wistar. Tahap penelitian yang harus dikerjakan adalah mengisolasi DNA genam hati tikus dengan atau tanpa menggunakan kit Menelusuri data urutan nukleotida DNA AFP yang akan diisolasi. Merancang sepasang oligonukleotida primer. Mengisolasi fragmen DNA AFP dengan cara PCR dan memurnikannya dengan cara elektroelusi. Selanjutnya memotong fragmen DNA produk PCR tersebut dengan enzim endonuklease restriksi spesifik. Akhirnya membaca urutan nukleotida fragmen tersebut. Hasil dan Kesimpulan : Diperoleh fragmen DNA AFP produk PCR sepanjang 292pb dengan menggunakan sepasang oligonukleotida primer Twister I (5'CATAAGATAGAAGTGACCCCTGTG3') dan Twister II (5 'GCATCTTA CCTATTCCAAA CTCAT3 ' ). Fragmen DNA tersebut mengandung elemen promotor gen dan gen penyandi AFP dengan urutan nukleatida yang sama dengan urutan nukleotida pada fragmen DNA AFP yang diperoleh dari bank gen. Pemotongan fragmen DNA tersebut dengan menggunakan enzim menghasilkan fragmen DNA sepanjang 110pb yang hanya mengandung gen penyandi AFP. Fragmen DNA ini akan digunakan sebagai kontrol negatif untuk membuktikan pentingnya elemen promotor gen AFP dalam proses pengaturan ekspresi gen AFP."

"Tesis ini adalah kajian filosofis atas pengembangan komputasi DNA yang menggunakan analisis Arkeologi dan Genealogi dari Michel Foucault. Dalam penelitian ini, ditemukan adanya kesejajaran antara tiga episteme yang telah diungkap Foucault dengan tiga teknologi komputasi yang telah dikembangkan (penerapan metode Arkeologi) dan suatu jenis exercise atas kekuasaanpengetahuan sebagaimana diurai Foucault dengan titik tekan pada normalisasi, pengembangan model Artificial Intelligent Creatures, dan kemungkinan model panopticon molekuler (penerapan metode Genealogi). Hasil penelitian ini juga mengandaikan bahwa problem yang muncul harus disikapi dengan rumusan etika baru. Sebab, etika yang sudah dikembangkan tidak dapat mengatasi persoalan yang sekiranya dapat terjadi dengan dikembangkannya komputasi DNA.

---

This thesis is a philosophical study about DNA computation development which uses Genealogical and Archaeological analytics from Michel Foucault. In this thesis had been found parallelism between three episteme which described by Foucault with the three technology of computation (Archaeological applied) and a kind of exercise of knowledge-power as identified by Foucault which focusing in normalization, developing Artificial Intelligent Creatures, and possibility of molecular panopticon (Genealogical applied). This thesis supposes to formulate a new ethical approach. It is because the ethics which were developed not have an adequacy to solve a problematical discourse which comes from DNA computation development."

"[ABSTRAKPendahuluan: Infeksi dengue merupakan salah satu penyakit endemik di daerah tropis dan subtropis yang disebabkan oleh virus dengue (DENV). Hingga saat ini belum ada antiviral yang efektif untuk infeksi dengue. Penyebaran dan sirkulasi serotipe DENV berfariasi di setiap lokasi geografi, hal ini menyulitkan dalam melakukan evaluasi vaksin DENV. Oleh karena itu perlu dikembangkan kandidat vaksin DENV menggunakan strain Indonesia supaya dapat memberikan proteksi maksimal. Pada peneltian ini dikembangkan kandidat vaksin DNA tetravalen DENV berbasis gen prM-E DENV strain Indonesia.Metode: Konstruksi plasmid rekombinan kandidat vaksi dilakukan dengan cara menyisipkan gen prM-E setiap serotipe DENV ke dalam vektor pUMVC4a. Gen prM-E DENV merupakan strain Indonesia, yang diamplifikasi dari serum pasien yang terinfeksi dengan virus ini. Kemampuan plasmid rekombinan mengekspresikan protein prM-E DENV diuji di sel mamalia. Kemampuan kandidat vaksin menginduksi respon imun humoral dievaluasi secara monovalen dan tetravalen di mencit jenis ddY. Titer IgG anti dengue diperiksa menggunakan teknik ELISA, sedangkan titer antibodi netralisasi di tentukan dengan uji FRNT. Proteksi vaksin terhadap mencit yang diimunisasi dievaluasi dengan melakukan uji tantang menggunakan sel K562 yang diinfeksi DENV-2. Viremi virus di tentukan dengan menggunakan teknik foccus assay.Hasil: Konstruksi plasmid rekombinan kandidat vaksin DENV-1 dan DENV-3 sudah berhasil dilakukan. Plasmid dapat mengekspresikan protein prM-E DENV di sel mamalia, namun karakteristik dan kinetik protein masih belum dapat diketahui dengan jelas. Keempat kandidat vaksin DNA yang sedang dikembangkan dapat menginduksi respon imun, baik secara monovalen maupun tetravalen. Imunisasi secara tetravalen dapat memberikan proteksi pada mencit yang diuji tantang dengan sel K562 yang diinfeksi dengan DENV-2.;

---

ABSTRACTIntroduction: Dengue infections are caused by dengue viruses (DENV) and are endemic in tropical and subtropical regions. At present, there is no effective antiviral treatment for dengue infection. Distribution and circulation of DENV serotypes varies by geographic location, it is difficult to evaluate DENV vaccine. Therefore, it is necessary to develop a vaccine candidate DENV using Indonesian strains in order to provide maximum protection. However, in this study, we constructed a recombinant plasmid-based prM-E gene from the Indonesia strain as a DENV DNA vaccine candidate.Methode: The recombinant plasmid was prepared by inserting the prM-E gene from each DENV serotypes into the plasmid backbone pUMVC4a. prM-E gene an Indonesia strain, which was amplified from patient sera infected with DENV. The ability of the recombinant plasmid expressing the prM-E DENV protein tested in mammalian cells. The ability of candidate vaccines induce humoral immune responses were evaluated monovalent and tetravalent in ddY mice. IgG titers of anti-dengue examined using ELISA technique, while neutralizing antibody titers determined with FRNT test. Vaccine protection against the immunized mice was evaluated by conducting challenge test using K562 cells infected by DENV-2. Viremia was determined by using the foccus assay.Result: Construction of recombinant plasmid vaccine candidate DENV-1 and DENV-3 was successfully performed. Plasmids can express prM-E DENV proteins in mammalian cells, but the characteristics and kinetics of protein still can not clearly known. Fourth DNA vaccine candidate that is being developed to induce an immune response, either monovalent or tetravalent. Tetravalent immunization may provide protection in mice challenged tested with K562 cells infected with DENV-2.;Introduction: Dengue infections are caused by dengue viruses (DENV) and are endemic in tropical and subtropical regions. At present, there is no effective antiviral treatment for dengue infection. Distribution and circulation of DENV serotypes varies by geographic location, it is difficult to evaluate DENV vaccine. Therefore, it is necessary to develop a vaccine candidate DENV using Indonesian strains in order to provide maximum protection. However, in this study, we constructed a recombinant plasmid-based prM-E gene from the Indonesia strain as a DENV DNA vaccine candidate.Methode: The recombinant plasmid was prepared by inserting the prM-E gene from each DENV serotypes into the plasmid backbone pUMVC4a. prM-E gene an Indonesia strain, which was amplified from patient sera infected with DENV. The ability of the recombinant plasmid expressing the prM-E DENV protein tested in mammalian cells. The ability of candidate vaccines induce humoral immune responses were evaluated monovalent and tetravalent in ddY mice. IgG titers of anti-dengue examined using ELISA technique, while neutralizing antibody titers determined with FRNT test. Vaccine protection against the immunized mice was evaluated by conducting challenge test using K562 cells infected by DENV-2. Viremia was determined by using the foccus assay.Result: Construction of recombinant plasmid vaccine candidate DENV-1 and DENV-3 was successfully performed. Plasmids can express prM-E DENV proteins in mammalian cells, but the characteristics and kinetics of protein still can not clearly known. Fourth DNA vaccine candidate that is being developed to induce an immune response, either monovalent or tetravalent. Tetravalent immunization may provide protection in mice challenged tested with K562 cells infected with DENV-2., Introduction: Dengue infections are caused by dengue viruses (DENV) and are endemic in tropical and subtropical regions. At present, there is no effective antiviral treatment for dengue infection. Distribution and circulation of DENV serotypes varies by geographic location, it is difficult to evaluate DENV vaccine. Therefore, it is necessary to develop a vaccine candidate DENV using Indonesian strains in order to provide maximum protection. However, in this study, we constructed a recombinant plasmid-based prM-E gene from the Indonesia strain as a DENV DNA vaccine candidate.Methode: The recombinant plasmid was prepared by inserting the prM-E gene from each DENV serotypes into the plasmid backbone pUMVC4a. prM-E gene an Indonesia strain, which was amplified from patient sera infected with DENV. The ability of the recombinant plasmid expressing the prM-E DENV protein tested in mammalian cells. The ability of candidate vaccines induce humoral immune responses were evaluated monovalent and tetravalent in ddY mice. IgG titers of anti-dengue examined using ELISA technique, while neutralizing antibody titers determined with FRNT test. Vaccine protection against the immunized mice was evaluated by conducting challenge test using K562 cells infected by DENV-2. Viremia was determined by using the foccus assay.Result: Construction of recombinant plasmid vaccine candidate DENV-1 and DENV-3 was successfully performed. Plasmids can express prM-E DENV proteins in mammalian cells, but the characteristics and kinetics of protein still can not clearly known. Fourth DNA vaccine candidate that is being developed to induce an immune response, either monovalent or tetravalent. Tetravalent immunization may provide protection in mice challenged tested with K562 cells infected with DENV-2.]"

"ABSTRAKPendahuluan :Trypanosoma evansi adalah protozoa berflagella yang bersirkulasidi dalam darah secara ekstraseluler sebagai agen penyakit Surra serta menyerangseluruh hewan vertebrata, serta berpotensi sebagai zoonosis. Informasi virulensiisolat T. evansi sangat dibutuhkan untuk penentuan strategi pengobatan Surra didaerah wabah dan endemis. Penelitian ini bertujuan untuk mengetahui variasivirulensi isolat T. evansi yang dikoleksi dari berbagai wilayah di Indonesiatermasuk memperoleh marka genetik serta mengetahui profil sitokin pada mencit.Disamping itu, dilakukan juga uji serologis pada peternak di daerah wabah SurraMetode : Sebanyak 32 isolat lokal T. evansi dikonfimasi dengan PCR multiplex(ITS-1; Te Ro Tat 1,2 VSG dan ESAG6/7), selanjutnya diuji virulensinya denganmenginfeksikan104 parasit pada mencit galur DDY. Studi genotyping populasiT. evansi dievaluasi dengan 8 marka mikrosatelit Tbb-1, Tbb-5, Tbb-9, Tbb-10,MORF2-CA, M6C8-CA, MEST-19AT, MT3033-AT. Dua isolat yang berbedavirulensi (tinggi-Bang87 dan rendah-Pml 287) dipilih untuk uji imunopatogenitassedangkan serum peternak diuji dengan metode FELISA dan CATT T. evansi.Hasil : Dari 32 isolat tersebut terbagi menjadi 17 isolat bervirulensi tinggi, 11isolat bervirulensi moderat dan 4 isolat bervirulensi rendah dengan 8 pola tingkatparasitemia. Analisis Neigbour Joining (NJ) terhadap 8 lokus berdasarkan MultiLokus Genotipe (MLG) mikrosatelit terbagi menjadi 4 populasi, yaitu MLG A,MLG B, MLG C dan MLG D. Analisis terhadap struktur populasi jugamemberikan hasil yang sama dengan terbentuknya 4 klaster. Hasil ini jugamembuktikan bahwa marka yang digunakan bersifat spesifik lokasi. Sebanyaktiga marka mengindikasikan adanya asosiasi antara virulensi dan MLG (Tbb-1,M6C8-CA dan MEST-19). Kadar IFN-γ meningkat secara tajam pada mencityang diinfeksi isolat Bang 87 pada 4hpi berkorelasi negatif yang signifikan(p<0,05) dengan kadar IL-10, sedangkan pada mencit yang diinfeksi isolat Pml287, peningkatan kadar IFNγ berkorelasi positif dengan kadar IL-10. Kematiandini pada mencit yang diinfeksi isolat Bang 87 disebabkan oleh sindrom responinflamasi sitemik. Hasil uji serologis menunjukkan bahwa 4 dari 24 serumpeternak (16,67%) didaerah wabah positif dan seluruh serum negatif untukdaerah non wabah.Kesimpulan : Variasi virulensi T. evansi isolat Indonesia memiliki karaktermolekular yang berbeda serta menginduksi pola mediator sitokin pro danantiinflamasi yang berhubungan dengan pola manifestasi patologi yang berbeda.Marka mikrosatelit pada studi ini mampu mengidentifikasi asal usul sumberinfeksi, dan tingkat virulensi isolat yang sedang bersirkulasi. Surra berpotensisebagai emerging zoonosis, terutama bagi peternak didaerah wabah dan endemis.

---

ABSTRACTIntroduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas;Introduction: Trypanosoma evansi is an extracellular homoflagellate ofprotozoan blood causing Surra. The disease attacks all vertebrates and potentiallyas zoonosis. Virulence analysis of T. evansi is a fundamental knowledge todetermine treatment strategies of Surra in both outbreak and endemic areas. Theaims of this study was to determine virulence variation of T. evansi isolatescollected from various regions in Indonesia and to obtained genetic markers aswell as cytokine profile in mice. In addition, serological test was also carried outto farmers living in a Surra outbreak areaMethods: Total of 32 isolates of T. evansi corfirmed with multiplex PCR (ITS-1;Te Ro Tat 1.2 VSG and ESAG6 / 7), were further tested with inoculation 104parasite in DDY mice strain. The population genotype study of T. evansi wasevaluated with 8 microsatellite markers (Tbb-1, Tbb-5, Tbb-9, Tbb-10-CAMORF2, M6C8-CA, MEST-19AT, MT3033-AT). Two different virulenceisolates, high-Bang87 and low-PML287 was selected to cytokine profile analysisusing ELISA, while farmers sera were tested using CATT and FELISA kitsResults: A total of 32 local isolates of T. evansi tested were divided into threedifferent virulences, i.e. 17 high virulence isolates, 11 moderate virulence and 4low virulence isolates forming 8 pattern parasitemia levels. Based on NeigbourJoining (NJ) on 8 Microsatellite Multilocus Genotype (MLGs) was grouped into4 populations (MLG A, MLG B, MLG C and MLG D). Stucture populationanalysis also provided the similar result generating 4 clusters. These resultsindicated that the markers used in this study had a specific location property.Three markers (TBB-1, and MEST M6C8-CA-19) showed an associationbetween virulence and MLG. IFN-γ levels increased significantly in miceinfected with Bang 87 isolate on 4th day post infection (dpi) having a significantnegative correlation (p <0.05) with increased IL-10 levels, whereas in miceinfected by PML 287 isolate, IFN-γ levels were positively correlated with IL- 10levels. Early death in mice infected with Bang87 isolates was caused by systemicinflammatory response syndrome (SIRS). Result of serological test showed that 4 outof 24 farmers sera (16.67%) from outbreak areas are positive and all sample fromfree area are negative.Conclusion: Virulence variation of T. evansi isolates from Indonesia hasdifferent molecular character and induces cytokine pattern of pro and antiinflammatorymediators associated with distinct patterns of pathologicalmanifestations. The microsatellite markers found in this study are able to identifyorigin of infection sources dan determine virulence of isolates that circulate on theoutbreak area. Surra is potential new emerging disease, particularly for farmers orimmunosurpressed individuals who living in both endemic and outbreak areas"

"ABSTRAKSalah-satu variasi DNA mitokondria manusia adalah delesi 9-pasangan basa (del 9-pb) daerah intergenik COII/tRNA LYS. Del 9-pb merupakan salah satu penanda genetik yang dapat digunakan untuk mempelajari hubungan kekerabatan antarpopulasi. Penelitian del 9-pb antarpopulasi suku-suku di Indonesia belum pernah dilakukan. Secara antropologi, suku Batak dan suku Toraja memiliki nenek moyang Proto Melayu, sedangkan suku Jawa memiliki nenek moyang Deutero Melayu. Penelitian ini bertujuan untuk mengetahui nilai persentase del 9-pb pada populasi suku Batak, suku Toraja, dan suku Jawa agar didapatkan informasi genetik untuk mempelajari hubungan kekerabatan antara ketiga suku tersebut. Metode yang digunakan adalah metode amplifikasi dengan PCR (Polymerase Chain Reaction) dan elektroforesis pada gel agarosa 5% dengan pewarnaan etidium bromida. Hasil pengamatan persentase del 9-pb ketiga suku tersebut adalah: suku Batak 19,84% dengan menggunakan 126 sampel, suku Toraja 32,77% dengan 119 sampel, dan suku Jawa 25,47% dengan 106 sampel. Nilai persentase del 9-pb meningkat bila urutan populasi adalah sebagai berikut: suku Batak—suku Jawa—suku Toraja."

"ABSTRAKSebagai Iangkah awal untuk menjelaskan hubungan kekerabatan antar spesies Tarsius Storr, 1780, dilakukan studi fiogenetik menggunakan data sekuen DNA mitokondria daerah ND4—ND5. Pada analisis tersebut di akukan pendekatan maximum parsimony dengan ap ikasi komputer Phylogenetic Analysis Using Parsimony (PAUP). Hasil anal isis men unjukkan bahwa posisi genus Tarsius dalam ordo Primata perlu dipisahkan dan subordo Anthropoidea ataupun ordo Prosimii. Selain itu pada kelompok Tarsius di Filipina lebih berkerabat dengan kelompok Tarsius di P. Sulawesi, dibandingkan dengan kelompok Tarsius di P. Kalimantan dan P. Sumatra. Adapun kelompok-kelompok Tarsius yang diperbandingkan antara lain T. syrichta (Linnaeus, 1758) di Filipina; T. spectrum (Pallas, 1778) dan T. sangirensis Meyer, 1896 di P. Sulawesi; serta T. bancanus Horsfield, 1821 di P. Kalimantan dan P. Sumatra."