Hasil Pencarian  ::  Simpan CSV :: Kembali

"Synopsis"As a communicator and researcher engaged forensic DNA analyses, John Butler is at the pinnacle of his profession. As with the previous two volumes in this series, Butler leaves no stone unturned in the clarity of his A to Y coverage of forensic DNA interpretation. This book is bound to find its way onto the fingertips of practitioners, attorneys, and students."--Richard Saferstein, Ph.D., Chief Forensic Scientist (Retired) ".It is an excellent companion to his prior book on methodology, providing important information on interpretation of results. The book should prove valuable to all people involved in processing and interpreting results used in forensic genetics and criminal investigation."-- Bruce McCord, Ph.D., Professor, Florida International University "Advanced Topics in DNA Typing/Interpretation is Dr. John Butler's best book yet in his critically acclaimed series of DNA text books..."-- Stephen Patrick Hogan Adjunct Associate Professor of Biological Science and Criminal Justice, State University of New York at Albany Read less"

"DNA typing -- the analysis of a biological sample for a person's genetic signature -- has led to the unprecedented exoneration of hundreds of wrongfully convicted people. And every day we hear stories about how police used DNA to capture a dangerous rapist or killer. Reading these accounts, it is hard not to think of DNA typing as an unmitigated good. Who can argue with a technology that helps catch bad guys and correct law enforcement mistakes? But there is a darker side to this story -- a version less likely to play out on dramatic television shows. In Inside the Cell, Erin Murphy shows how DNA typing can be subject to misuse, mistake, and error, and lead to a police state run amok"

"DNA Sequencing by Hybridization (DNA SBH) adalah suatu proses pembentukan barisan nukleotida suatu rantai DNA dari kumpulan fragmen yang disebut spektrum. Spektrum tersebut diperoleh dari proses biokimia yang disebut hibridisasi. DNA SBH dapat dipandang sebagai masalah optimisasi yang dapat diselesaikan dengan menggunakan algoritma genetik. Prinsip kerja algoritma genetik berdasarkan pada teori evolusi Charles Darwin. Pada skripsi ini akan dibahas penerapan kinerja algoritma genetik pada DNA SBH. Terdapat tiga tahapan penting dalam algoritma genetik, yakni proses seleksi, crossover, dan mutasi. Jenis metode yang digunakan pada proses seleksi, crossover, dan mutasi secara berturut-turut adalah metode yang merupakan kombinasi antara roulette wheel dan deterministic, structured crossover, dan swap mutation. Kinerja algoritma genetik akan diuji dengan menggunakan data dari Gen Bank dan masalah DNA SBH yang dibuat secara acak. Selain itu juga akan dilihat pengaruh perubahan nilai probabilitas crossover (c) dan probabilitas mutasi (m) terhadap kinerja algoritma genetik untuk DNA SBH. Berdasarkan hasil percobaan diperoleh bahwa algoritma genetik cukup baik digunakan pada DNA SBH. Selain itu, perubahan nilai probabilitas crossover (c) dan probabilitas mutasi (m) ternyata mempengaruhi kinerja algoritma genetik dalam memperoleh solusi."

"Elektroforesis merupakan peristiwa pergerakan molekul-molekul kecil yang dibawa oleh muatan listrik akibat adanya pengaruh medan listrik. Peristiwa ini diaplikasikan dalam bidang kedokteran untuk mengidentifikasi DNA, dengan alat yang disebut Agarose Gel Electrophoresis. Ketika alat ini diberi arus listrik DNA yang bermuatan negatif akan bermigrasi ke kutub positif, dimana fragmen DNA yang lebih kecil akan bermigrasi lebih jauh dibanding fragmen yang lebih besar. Jauh migrasi DNA ini dapat diukur dan dianalisa sehingga didapatkan massa moelekul dan jenis DNA. Akan tetapi arus listrik yang digunakan untuk membuat fragmen DNA bermigrasi dapat menimbulkan panas. Panas yang berlebih harus dihindari karena dapat menyebabkan Agarose Gel electrophoresis tidak dapat beroperasi sebagaimana mestinya, oleh karena itu pada alat ini digunakan sistem pendingin. Pengujian ini bertujuan untuk melihat pengaruh penggunaan heat pipe terhadap sistem pendingin termoelektrik yang digunakan Agarose Gel Electrophoresis. Pengaruh dilihat dari hasil visualisasi migrasi DNA yang dihasilkan oleh alat ini.

---

Electrophoresis is a phenomenon which related to the movement of small particles which is carried by the electrons due to the electric field. This phenomenon is used in medical science as one of the DNA identification methods, with the instrument named Agarose Gel Electrophoresis. When the electric current is passed through the medium containing the DNA, the DNA that carry a negative charge will migrate towards the positive pole. The smaller DNA fragments is migrating further than the bigger ones. Then, distance of the migration can be measured and analyzed to get the DNA's molecul mass and its specification. When electric current is flowing, there comes heat. Overheating should be avoided to make sure the Agarose Gel Electrophoresis operates well. That's why this instrument is equipped with a cooling system. This research was conducted to find the effect of heat pipe using as a thermoelectric cooling system on Agarose Gel Electrophoresis. The effect can be analyzed by seeing the visualisation of DNA migration."

"Chromosomes are distinct dense bodies found in the nucleus of cells, composed of protein and DNA. containing genetic information in the form of linear sequences of oases (A,T,C,G). The DNA in an individual chromosome is one, long molecule which is highly coiled and condensed (figure l).The total number of bases in all the chromosomes of a human cell is approximately six billion and individual chromosomes range from 50 to 250 million bases. The DNA sequence for a single trait is called a gene. Each chromosome contains a few thousand genes, which range in si?e from a few thousand bases up to 2 million bases."

"Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Pada orang sehat (imunokompeten) infeksi biasanya tidak disertai gejala klinis, sedangkan pada penderita imunokompromais terutama pada penderita AIDS infeksi dapat berakibat fatal. Infeksi primer pada wanita hamil dapat mengakibatkan terjadinya transmisi melalui plasenta ke janin. Karena itu pemeriksaan laboratorium mutlak diperlukan untuk menentukan adanya infeksi T.gondii, sehingga pengobatan dapat diberikan dengan segera untuk menghindari kerusakan lebih lanjut.Penelitian ini bertujuan untuk menentukan apakah Polymerase chain reaction (PCR) dengan menggunakan gen P30 dapat mendeteksi DNA T.gondii. Pada DNA yang diisolasi dilakukan PCR terhadap target gen P30 menurut metode menurut metode Weiss dkk. dan Chang & Ho. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAGCCT3'. Sampel DNA yang digunakan untuk PCR dengan target gen P30 terdiri dari berbagai macam bahan yaitu : (a) DNA murni T.gondii dengan berbagai konsentrasi, (b) campuran DNA murni T.gondii dengan DNA darah manusia sehat, (c) DNA dari takizoit yang berasal dari campuran 99 ml darah manusia sehat dengan 1 ml suspensi takizoit yang masing-masing mengandung 1000,100, 50, 40, 30, 20 dan 10 takizoit. PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gondii pada elektroforesis.Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi pada sampel DNA murni T.gondii adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dan pada sampel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit. Dengan demikian dapat disimpulkan PCR dengan menggunakan target gen P30 dapat digunakan untuk mendeteksi DNA T.gondii.

---

Detection of P30 gene to diagnosis of toxoplasmosis by using polymerase chain reaction. Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage.The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5'CACACGGTTGTATGTCGGTTTCGCT3' and oligo 2: 5'TCAAGGAGCTCAATGTTAC GCT3'. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed.The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia."

"Sifat transportasi elektron dalam molekul DNA Aperiodik dan Molekul DNA G4 telah dipelajari. Kedua molekul DNA ini, dimodelkan dengan menggunakan Hamiltonian ikatan kuat tight binding . Sifat transpor elektron dipelajari dengan menghitung probabilitas transmisi elektron menggunakan metode transfer matriks dan hamburan matriks secara bersamaan. Formalisme Landauer-B ttiker digunakan dalam menghitung karakteristik I-V molekul dari probabilitas transmisi. Pada molekul DNA Aperiodik dan DNA G4 sudah dilakukan perhitunganan untuk DNA berukuran 32 pasangan basa. Parameter perhitungan yang diperhatikan adalah gerakan sudut putar pasangan basa yang berhubungan dengan konstanta loncatan elektron antar basa melalui teori semi-empiris Slater-Koster-Harrison. Hasil perhitungan dianalisis dengan memperhatikan variasi frekuensi getar gerak memutar, temperatur, dan energi gangguan backbone. Hasil perhitungan pada molekul DNA Aperiodik dan DNA G4 menunjukkan bahwa transpor muatan DNA bergantung pada frekuensi gerak memutar pasangan antarbasa. Jika frekuensi tinggi, terjadi peningkatan arus dan probabilitas transmisi. Dan ketika temperatur ditingkatkan, probabilitas transmisi dan arus menurun dan tegangan ambang meningkat di tiap variasi frekuensi getar gerak memutar. Terakhir, jika nilai energi gangguan backbone yang diberikan semakin besar maka nilai transmisi, arus dan tegangan ambang menurun. Pada molekul DNA G4 transmisi dan kurva I-V lebih tinggi dari molekul DNA Aperiodik.

---

Electron transport characteristics in G4 and Aperiodic DNA molecules have been studied. Both molecules are modelled using tight binding Hamiltonian. Electron transport characteristics are studied by calculating electron transmission probability using matrix transfer and scattering matrix methode simultaneously. Landauer B ttiker formalism is used in calculating the I V characteristics of molecules from transmission probability. The calculation in Aperiodic and G4 DNA molecules is done for 32 base pairs long DNA. Variable in the calculation is twisting motion angle of base pairs which is correlated to electron the hopping constant between bases within Slater Koster Harrison semi empirical theory.

Calculation results are analyzed in variation of twisting motion frequency, temperature, and backbone disturbance energy. The calculation result in Aperiodic and G4 DNA molecules shows that DNA change transport on DNA depends on twisting motion frequency of bases. When the frequency become higher, the current and transmission probability will increase. Moreover, when the temperature increases, the current and transmission probability decreases, then threshold the voltage becomes higher for all twisting motion frequency. Lastly, as the backbone disturbance energy become large, the current and transmission decreases, then the threshold voltage will be small. In G4 DNA molecule the transmission and curve I V are higher, than in Aperiodic DNA molecule. "

"Tuberkulosis (TB) disebabkan oleh infeksi kuman Mycobacterium tuberculosis merupakan satu dari sepuluh penyebab kematian tertinggi di dunia yang dapat dicegah melalui vaksinasi. Vaksin BCG sebagai satu-satunya vaksin TB, memiliki beberapa kekurangan, diantaranya tingkat proteksi yang tidak merata di populasi orang dewasa dan kekhawatiran aplikasinya pada populasi imunokompromais, hal ini mendorong dikembangkannya vaksin TB alternatif. PE11 merupakan protein yang bertanggung jawab dalam rekonstruksi komponen lipid dinding sel M. tuberculosis dan berdasarkan analisis in-siliko diketahui memiliki domain pengenalan terhadap antibodi dan MHC-II. Dalam studi ini, gen pe11 dari M. tuberculosis strain Beijing diinsersikan ke dalam plasmid pcDNA3.1, pcDNA3.1-pe11, yang kemudian diuji kemampuannya dalam menginduksi respon imun humoral dan mediator seluler pada mencit Balb/c sebagai bentuk DNA vaksin. Berdasarkan uji western blot, respon imun humoral berupa IgG spesifik terhadap protein rekombinan PE11-His berhasil dikonfirmasi. Selain itu, mediator imun seluler dari splenosit mencit pasca vaksinasi dan pajanan antigen secara in-vitro menunjukkan adanya peningkatan produksi IL-12, IFN-γ dan IL-4 dibandingkan dengan kelompok kontrol, namun tidak terhadap sitokin IL-10.

---

Tuberculosis (TB) caused by infection bacteria Mycobacterium tuberculosis, one of ten causes of death in the world that can be prevented through vaccination. The BCG vaccine, as the only TB vaccine, has several drawbacks, including an uneven level of protection in adult population and risk application in immunocompromised population, this has led to the development of an alternative TB vaccine. PE11 is a protein that is responsible for the reconstruction of the lipid component of the cell wall of M. tuberculosis and based on in-silico analysis is known to have the recognition domain for antibodies and MHC-II. In this study, the pe11 gene from the Beijing strain of M. tuberculosis was inserted into the plasmid pcDNA3.1, pcDNA3.1-pe11, then tested for its ability to induce humoral immune responses and cellular mediators in Balb/c mice as a form of vaccine DNA. Based on the western blot test, the specific IgG humoral immune response to the recombinant protein PE11-His was confirmed. In addition, cellular immune mediators from post-vaccination mice splenocytes and in-vitro antigen exposure showed increased production of IL-12, IFN-γ and IL-4 compared to the control group, but not to the IL-10 cytokine."