Hasil Pencarian  ::  Simpan CSV :: Kembali

"Salah satu cara untuk mengetahui fungsi dari ekpresi gen (DNA/Protein) adalah dengan analisis kelompok (Clustering). Metode pengelompokan HOPACH mengkombinasikan agglomerative dan partisi. Partisi yang dapat digunakan antara lain PAM, SOM, dan K-Means yang termasuk dalam hard clustering. Dalam beberapa kasus karena beberapa hal pengelompokkan objek dengan hard clustering menjadi kurang tepat. Karena itu kemudian muncul teori himpunan fuzzy (kabur, tidak pasti) yang mendasari berkembangnya metode fuzzy clustering. Salah satu metode fuzzy clustering adalah metode Fuzzy c-means (FCM) yang merupakan perkembangan dari k-means. Hasil dari penerapan algoritma partisi fuzzy c-means dalam metode pengelompokan HOPACH adalah algortima pengelompokan dengan langkah-langkah: ekstraksi ciri dengan n-mers frecuency, normalisasi, partisi dengan FCM, menentukan kelompok terbaik dengan mencari nilai MSS minimum, ordering, dan collapsing. Hal ini dilakukan berulang kali sampai kriteria berhenti terpenuhi. Penerapan algoritma ini dilakukan dengan program R. Pada penerapan algoritma partisi dalam metode HOPACH clustering, langkah normalisasi tidak perlu dilakukan, karena FCM sendiri sudah mengatasi masalah adanya outliers. Kekurangan dari penerapan ini adalah running time program yang cukup lama untuk nilai batas toleransi yang kecil.

---

One of the way to know the function of gene expression by clustering analysis. HOPACH clustering is combine thea agglomerative and partition method. The partition are PAM, SOM, and K-means which is part of hard clustering. In some cases because of the placement object in to a cluster with hard clustering can cause an error. So that is the reason why fuzzy set theory occurs and became the foundation of fuzzy clustering. One of the fuzzy clustering methods is Fuzzy C-means (FCM) which is developed from K-means.

The result from the implementation of FCM partitioning algorithm in HOPACH clustering method is the clustering algorithm which the steps are: characteristic extraction, normalization, partition using FCM, choosing the best cluster with the minimum MSS, ordering and collapsing. The process need done by iteration until the stopping criteria has reached. The implementation of this algorithm is use R program. In the implementation of FCM partitioning algorithm in HOPACH clustering method, normalization process can be deleted, because the FCM already sole the outliers problem. This disadvantage of this implementation is the running time program need quite along time for the small tolerance limits."

"DNA forensik adalah teknik identifikasi individu berdasarkan profil DNA STR. Bercak darah merupakan barang bukti utama dalam kejadian kriminal. Paparan lingkungan diketahui merusak DNA, oleh karena itu penelitian ini menganalisis pengaruh lingkungan terhadap marka STR untuk kepentingan forensik. Bercak darah dari 12 individu diletakkan pada kain katun steril dikelompokkan menjadi 3 kelompok perlakuan lingkungan (dalam, luar dan tanah); 4 kelompok perlakuan lama paparan (1, 7, 14, dan 28 hari). DNA diekstraksi, dikuantifikasi menggunakan PCR real time kuantitatif, dilanjutkan amplifikasi 24 lokus STR. Stabilitas DNA diukur berdasarkan tingkat keberhasilan amplifikasi alel pada 24 lokus STR. Hasil penelitian menunjukkan hubungan bermakna (P<0.05) antara stabilitas DNA dengan pengaruh lingkungan, yang ditemukan pada lama paparan hari ke-7, 14 dan 28. Paparan lingkungan dalam tanah menunjukkan pengaruh kuat terhadap stabilitas DNA. Hasil korelasi Gamma menunjukkan paparan lingkungan memiliki tingkat korelasi yang tinggi terhadap stabilitas DNA, yaitu semakin ekstrim lingkungan dan semakin lama paparan lingkungan tersebut, stabilitas DNA semakin menurun ditunjukkan dengan terjadinya beberapa loss of heterozigosity dan allelic drop-out. Analisis pada tiap lokus menunjukkan semakin panjang fragmen alel pada lokus semakin mudah alel tersebut terdegradasi. Pada penelitian ini lokus CSF1PO (<350 pb), SE33 (360 pb) dan TPOX (250 pb) memiliki kecenderungan allelic drop-out paling tinggi.

---

Forensic DNA is an identification technique based on STR DNA profile. Blood stain is the main evidence in criminal act. Recent researches showed that environment have role to DNA degradation, therefore this research was designed to show environmental effect on DNA STR for forensic application of blood stain. Blood from 12 people dropped on sterile cottons and divided on 3 groups environmental (room, outdoor, soil). Each group has 4 sub-treatments time of environmental exposure (1, 7, 14, 28 days). DNA extracted from treated blood stain, quantified with real time qPCR, then 24 STR locus amplified on multiplex PCR. DNA stability measured based on amplification success rate of 24 STR locus. The results show that there were significant association (P<0.05) between stability DNA and environment effect. DNA on soil has the lowest stability among three environment condition. Significant differences were shown more significant at 28 days. Based on Gamma correlation analysis, the more extreme an environment and the longer DNA being exposed, the more decrease stability of DNA. It was shown by LOH and allelic drop-out. The longer allele, the more increase the rate of DNA degradation. In this research CSF1PO (<350bp), SE33 (<360bp), and TPOX (<250bp) have the lowest stability."

"Pendahuluan: Barier alamiah berupa membrane sel, kompartemen endosom, dan membrane inti sel yang menghalangi DNA ekstraseluler untuk mencapai target kerja dalam inti sel dalam mengawali proses pembentukan protein transgen. Sistem penghantar DNA, dalam hal ini protein penghantar DNA (PPD) dikembangkan untuk menghindari penghalang seluler tersebut. Karena sel tubuh berada dalam keadaan tidak membelah, maka diharapkan PPD tersebut dapat berfungsi pada sel tidak membelah. Metodologi: Metodologi yang dipakai adalah telaah literature, pengkloningan, dan uji in vitro. Dilakukan telaah literature untuk mencari peptida yang memiliki 1) kemampuan untuk masuk ke dalam sel/ berfusi dengan membran sel hospes, 2) kemampuan mengikat DNA, 3) kemampuan menghantarkan DNA melalui nuclear localization signal (NLS). Sekuen protein diubah menjadi DNA dengan menggunakan perangkat lunak. Setelah menjadi fragmen DNA, maka langkah selanjutnya DNA di klon ke dalam plasmid pQE80L untuk menghasilkan plasmid rekombian pengekspresi PPD. PPD diperoleh dengan cara mengekspresikannya ke dalam sistem prokariota. Setelah PPD dimurnikan, dilakukan uji fungsi kemampuan PPD menghantarkan DNA pada sel kultur membelah dan tidak membelah. Hasil: Berdasarkan telaah literature dihasilkan 5 rancangan PPD ALMR, SIMR, VPMR, THB2 dan THB4. Studi bioinformatika menunjukkan THB4 tidak dapat mengikat DNA dan bergerak ke inti sel. Proses pengkloningan menghasilkan 4 klon dan salah satu dari 4 kandidat PPD, THB2, tidak dapat diekspresikan dalam prokariota. ALMR, SIMR dan VPMR memiliki kemampuan untuk mengikat DNA dan melindungi DNA dari efek nuclease. Uji in vitro menunjukkan hanya ALMR yang dapat menghantarkan pcDNA3.1eGFP ke inti yang ditandai oleh ekspresi transgen oleh CHOK1. Jika dibandingkan dengan Lipofectamine, efektivitas penghantaran DNA oleh ALMR pada sel membelah kurang efektif,namun penghantaran DNA oleh ALMR pada sel tidak membelah lebih efektif dibandingkan Lipofectamine. Penambahan ALMR ke dalam komplek Lipofectamine:DNA dapat meningkatkan efisiensi penghantaran DNA dan viabilitas sel. Kesimpulan: PPD yang dapat mengikat, melindungi, dan menghantarkan DNA ke dalam sel membelah dan tidak membelah telah berhasil diperoleh. Penggabungan PPD dengan lipofectamine dapat meningkatkan efisiensi dan efektivitas penghantaran DNA kedalam sel tidak membelah serta meningkatkan viabilitas sel tidak membelah pasca transfeksi.

---

Background: The journey of extracellular DNA to reach its active site, nucleus, is dependent on its capability to overcome cellular barriers such as cell membrane, endosomal compartment and nuclear membran. To overcome such natural barriers, we developed peptide-mediated DNA delivery system that could deliver DNA especially into non-dividing cells as the majority of human cells are found in nondividing state.

Methodology: Based on literature studies we found peptides that have capability 1) to translocate/fuse with cellular membrane, 2) to bind DNA and protect DNA from nuclease 3) as nuclear localization signal (NLS). We convert peptides into DNA sequences by using software. DNA coding peptide-mediated DNA delivery systems were synthesized by commercially and manually using conventional PCR. The DNA fragments were cloned into prokaryote-expression systems. After expression and purification, peptide-mediated DNA delivery systems were tested their capability to increase the efficiency and effectiveness of the transformation of extracellular DNA in dividing and non-dividing cells.

Result: We constructs 5 candidates of peptide-mediated delivery system. One of them has no capability to bind DNA and located using nucleus. One of the rest peptidemediated delivery system could not be expressed in prokaryote system. Furthermore, three candidates have capability to binds DNA and protect DNA from nuclease degradation. Based on in vitro study, only one candidate has the capability to deliver DNA pcDNA3.1 eGFP into CHOK1 nucleus that marked by the expression of transgen. Compared to the Lipofectamine, a commercial delivery system, the capability of ALMR to deliver DNA into dividing cell is less efficient, but the capability of ALMR to deliver DNA into non-dividing cells is more efficient compare to Lipofectamine. The addition of ALMR into lipofectamine-DNA complex could increasing both the percentage of transgeneexpressing cells and viability of cell.

Conclusions: We have gained one peptide-mediated delivery system that could bind, protect and deliver DNA from extracellular into intracellular environment of dividing and non dividing cells. The addition of peptide-mediated delivery into Lipofectamine could increase the efectivity of DNA transformation and increase the cell viability."

"Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Pada orang sehat (imunokompeten) infeksi biasanya tidak disertai gejala klinis, sedangkan pada penderita imunokompromais terutama pada penderita AIDS infeksi dapat berakibat fatal. Infeksi primer pada wanita hamil dapat mengakibatkan terjadinya transmisi melalui plasenta ke janin. Karena itu pemeriksaan laboratorium mutlak diperlukan untuk menentukan adanya infeksi T.gondii, sehingga pengobatan dapat diberikan dengan segera untuk menghindari kerusakan lebih lanjut.Penelitian ini bertujuan untuk menentukan apakah Polymerase chain reaction (PCR) dengan menggunakan gen P30 dapat mendeteksi DNA T.gondii. Pada DNA yang diisolasi dilakukan PCR terhadap target gen P30 menurut metode menurut metode Weiss dkk. dan Chang & Ho. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAGCCT3'. Sampel DNA yang digunakan untuk PCR dengan target gen P30 terdiri dari berbagai macam bahan yaitu : (a) DNA murni T.gondii dengan berbagai konsentrasi, (b) campuran DNA murni T.gondii dengan DNA darah manusia sehat, (c) DNA dari takizoit yang berasal dari campuran 99 ml darah manusia sehat dengan 1 ml suspensi takizoit yang masing-masing mengandung 1000,100, 50, 40, 30, 20 dan 10 takizoit. PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gondii pada elektroforesis.Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi pada sampel DNA murni T.gondii adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dan pada sampel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit. Dengan demikian dapat disimpulkan PCR dengan menggunakan target gen P30 dapat digunakan untuk mendeteksi DNA T.gondii.

---

Detection of P30 gene to diagnosis of toxoplasmosis by using polymerase chain reaction. Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage.The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5'CACACGGTTGTATGTCGGTTTCGCT3' and oligo 2: 5'TCAAGGAGCTCAATGTTAC GCT3'. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed.The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia."

"DNA typing -- the analysis of a biological sample for a person's genetic signature -- has led to the unprecedented exoneration of hundreds of wrongfully convicted people. And every day we hear stories about how police used DNA to capture a dangerous rapist or killer. Reading these accounts, it is hard not to think of DNA typing as an unmitigated good. Who can argue with a technology that helps catch bad guys and correct law enforcement mistakes? But there is a darker side to this story -- a version less likely to play out on dramatic television shows. In Inside the Cell, Erin Murphy shows how DNA typing can be subject to misuse, mistake, and error, and lead to a police state run amok"

"Polusi lingkungan yang semakin parah disertai merebaknya pola hidup yang tidak sehat di masyarakat dapat meningkatkan sumber paparan bahan karsinogenik yang dapat menyebabkan penyakit kanker. Benzo[a]pirena dan Kobalt II adalah beberapa contoh bahan karsinogenik yang umum ditemukan di lingkungan. Kedua bahan ini dapat secara bersamaan masuk ke dalam tubuh melalui makanan atau udara tercemar dan merusak DNA. Pada penelitian ini dipelajari bagaimana pengaruh paparan BaP dan Co II secara in vitro pada 2'-deoksiguanosin terhadap pembentuka senyawa 8-hidroksi-2'-deoksiguanosin 8-OHdG. Peningkatan jumlah senyawa 8-OHdG dipakai sebagai indikator terjadinya kerusakan DNA sekaligus digunakan sebagai biomarker risiko kanker. Ditemukan bahwa kombinasi BaP dan Co II tidak memberikan efek sinergis dalam pembentukan 8-OHdG. Jumlah 8-OHdG yang terbentuk tidak berbeda jauh dengan jumlah yang dihasilkan dari paparan BaP saja. Paparan Co II melalui reaksi Fenton-Like memberikan hasil pembentukan 8-OHdG yang paling tinggi. Diikuti dengan BaP dan Co II , kemudian BaP dan H2O2.

---

Increasingly severe environmental pollution with an unhealthy pattern of life in the community can increase the source of exposure of carcinogenic substances that can cause cancer. Benzo a pirena and Cobalt II are some examples of carcinogenic substances commonly found in the environment. Both of these materials can simultaneously enter the body through food or polluted air and damage DNA. In this study we studied how the effect of BaP and Co II exposure in vitro on 2'-deoxyguanosine. An increase in the amount of the 8 hydroxy 2'-deoxyguanosin compound is used as an indicator of the occurrence of DNA damage as well as being used as a cancer risk biomarker. It was found that the combination of BaP and Co II did not provide a synergistic effect in the formation of 8 OHdG. The amount 8 OHdG formed does not vary much with the amount that resulted from BaP exposure alone. Exposure Co II through Fenton Like reaction gives the highest yield of 8 OHdG formation. Followed by BaP and Co II, then BaP and H2O2."

"Sifat transportasi elektron dalam molekul DNA Aperiodik dan Molekul DNA G4 telah dipelajari. Kedua molekul DNA ini, dimodelkan dengan menggunakan Hamiltonian ikatan kuat tight binding . Sifat transpor elektron dipelajari dengan menghitung probabilitas transmisi elektron menggunakan metode transfer matriks dan hamburan matriks secara bersamaan. Formalisme Landauer-B ttiker digunakan dalam menghitung karakteristik I-V molekul dari probabilitas transmisi. Pada molekul DNA Aperiodik dan DNA G4 sudah dilakukan perhitunganan untuk DNA berukuran 32 pasangan basa. Parameter perhitungan yang diperhatikan adalah gerakan sudut putar pasangan basa yang berhubungan dengan konstanta loncatan elektron antar basa melalui teori semi-empiris Slater-Koster-Harrison. Hasil perhitungan dianalisis dengan memperhatikan variasi frekuensi getar gerak memutar, temperatur, dan energi gangguan backbone. Hasil perhitungan pada molekul DNA Aperiodik dan DNA G4 menunjukkan bahwa transpor muatan DNA bergantung pada frekuensi gerak memutar pasangan antarbasa. Jika frekuensi tinggi, terjadi peningkatan arus dan probabilitas transmisi. Dan ketika temperatur ditingkatkan, probabilitas transmisi dan arus menurun dan tegangan ambang meningkat di tiap variasi frekuensi getar gerak memutar. Terakhir, jika nilai energi gangguan backbone yang diberikan semakin besar maka nilai transmisi, arus dan tegangan ambang menurun. Pada molekul DNA G4 transmisi dan kurva I-V lebih tinggi dari molekul DNA Aperiodik.

---

Electron transport characteristics in G4 and Aperiodic DNA molecules have been studied. Both molecules are modelled using tight binding Hamiltonian. Electron transport characteristics are studied by calculating electron transmission probability using matrix transfer and scattering matrix methode simultaneously. Landauer B ttiker formalism is used in calculating the I V characteristics of molecules from transmission probability. The calculation in Aperiodic and G4 DNA molecules is done for 32 base pairs long DNA. Variable in the calculation is twisting motion angle of base pairs which is correlated to electron the hopping constant between bases within Slater Koster Harrison semi empirical theory.

Calculation results are analyzed in variation of twisting motion frequency, temperature, and backbone disturbance energy. The calculation result in Aperiodic and G4 DNA molecules shows that DNA change transport on DNA depends on twisting motion frequency of bases. When the frequency become higher, the current and transmission probability will increase. Moreover, when the temperature increases, the current and transmission probability decreases, then threshold the voltage becomes higher for all twisting motion frequency. Lastly, as the backbone disturbance energy become large, the current and transmission decreases, then the threshold voltage will be small. In G4 DNA molecule the transmission and curve I V are higher, than in Aperiodic DNA molecule. "