Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 191 dokumen yang sesuai dengan query
cover
Hartman, Philip E.
New Delhi: Prentice Hall of India Private Limited, 1972
R 576.5 HAR g
Buku Referensi  Universitas Indonesia Library
cover
Pomerai De, David
Cambridge, UK: Cambridge University Press, 1985
591.9 POM f
Buku Teks  Universitas Indonesia Library
cover
Lisawati Susanto
"Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis pemeriksaan yang banyak dilakkukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay / ELISA) untuk medeteksi anti IgG dan Ig M terhadao T.gondii di dalam di dalam serum, namun pemeriksan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplamosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih. Penelitian ini bertujuan untuk menentukan konsentrai minimal DNA T. gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan targaet gen B1 dan gen P30 T. gondii. PCR terhdap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk dan aligo 2:5'TCTTTAAAAGCGTTCGTG GTC3' Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'. Pada penelitian ini PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk memberikan pita yang spesifik dan tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40, 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklur baru memberikan hasil pita spesifik T.gondii pada elektroforesis. Dapat disimpulkan bahwa uji yang menggunakan target gen B1 lebih sensitif dibandingkan dengan gen P30.

Toxoplasmagondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usuall performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is neede for diagnosing acute toxoplasmosis and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 gene as targets."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2002
AJ-Pdf
Artikel Jurnal  Universitas Indonesia Library
cover
cover
cover
Listyowati
"ABSTRACT
Latar Belakang: Serotonin merupakan monoamine yang berperan sebagai neurotransmitter di sistem saraf pusat dan perifer. Penelitian terbaru menyatakan bahwa serotonin juga mempengaruhi fungsi sel T dan sel B. Serotonin transporter merupakan pusat regulasi sistem serotonergic dan menyebar diekspresikan pada sel-sel di sistem imun. Polimorfisme pada promotor gen serotonin transporter (5-HTTLPR) menunjukkan aspek genetic pada terjadinya depresi. Cheilitis angularis merupakan penyakit kompleks dengan keterlibatan faktor geneti. Adanya polimorfisme ini menyebabkan inflamasi pada penyakit cheilitis angularis yang dimediasi oleh sel T dan meningkatnya prevalensi depresi pada pasien cheilitis angularis. Tujuan: Mendeteksi adanya polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR) pada penderita cheilitis angulari. Metode: Analisis polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR) dilakukan dengan metode PCR-VNTR. Analisis statistic dilakukan dengan uji Chi-square. Hasil: Dalam penelitian ini, pada kelompok cheilitis angularis ditemukan 24 sampel dengan genotip SS, 23 sampel dengan genotip LS, dan 3 sampel dengan genotip LL. Sedangkan pada kelompok non-cheilitis angularis, ditemukan 5 sampel dengan genotip SS, 18 sampel dengan genotip LS, dan 27 sample dengan genotip LL. Pada kelompok cheilitis angularis ditemukan 71 alel S dan 29 alel L, dan pada kelompok non-cheilitis angularis ditemukan 28 alel S dan 72  alel L. Kesimpulan: Terdapat perbedaan bermakna pada distribusi polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR)cheilitis angularis dengan non-cheilitis angularis (p = 0.001).

ABSTRACT
Serotonin is a monoamine acting as a neuromediator in the central and peripheral nervous system. Recently, serotonin has also been shown to influence T- and B-cell function. The serotonin transporter is central in the regulation of the serotonergic system and widely expressed on cells of the immune system. A functional length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) has been implicated in the genetic background of depression. Cheilitis angularis is a complex disease with a polygenetic inheritance. This polymorphism cause inflammation in cheilitis angularis mediated by the role of T cell and increased prevalence of depression in cheilitis angularis patients. To determine the relationship between the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism in cheilitis angularis patients in Indonesia. Analysis of the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism was observed by carrying out PCR method followed by electrophoresis for the analysis, without the usage of restriction enzyme. The chi-square test was used for statistical analysis. In this study, in the cheilitis angularis group there were 24 samples with SS genotype, 23 samples with LS genotype, and 3 samples with LL genotype. Whereas in the non-cheilitis angularis group, there were 5 samples with SS genotype, 18 samples with LS genotype, and 27 samples with LL genotype. In the cheilitis angularis group found 71 S alleles and 29 L alleles, and in the non-cheilitis angularis group 28 S alleles and 72 L alleles were found. There were significant differences in the distribution of the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism between cheilitis angularis and non-cheilitis angularis groups (p = 0.001). "
2018
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Hariyono Winarto
"Pendahuluan: Endometriosis merupakan suatu kelainan jinak ginekologi yang dapat mengalami transformasi menjadi kanker. Stres oksidatif diduga berperan dalam perkembangan penyakit endometriosis. Gen supresor tumor ARID1A banyak ditemukan termutasi dan inaktif pada kanker ovarium yang berhubungan dengan endometriosis. Tujuan penelitian adalah untuk menganalisis peran stres oksidatif terhadap ekspresi gen supresor tumor ARID1A dalam transformasi endometriosis menjadi ganas.
Metoda: Penelitian dimulai dengan 10 sampel jaringan kanker ovarium, 10 sampel endometriosis dan3 jaringan endometrium eutopik sebagai kontrol yang diisolasi mRNA dan proteinnya. Analisis ekspresi gen ARID1A pada tingkat mRNA dilakukan dengan pemeriksaan RT-qPCR dan pada tingkat protein dengan ELISA. Pada sel endometriosis dan kanker ovarium dilakukan analisis stres oksidatif dengan pemeriksaan aktivitas antioksidan MnSOD dan pemeriksaan kadar MDA sebagai salah bukti kerusakan salah satu komponen sel. Setelah itu dilakukan uji eksperimental pada kultur sel endometriosis dan endometrium eutopik sebagai kontrol. Kedua sel kultur diinduksi dengan H2O2 konsentrasi 0 nM, 100 nM, dan 1000 nM. Analisis dilakukan terhadap ketahanan hidup sel, kadar ROS dan ekspresi gen ARID1A pada tingkat mRNA dan protein.
Hasil: Efek induksi H2O2 dalam menekan ekspresi gen ARID1A sel endometriosis dan sel endometrium eutopik pada tingkat mRNA dan protein, bermakna, meskipun pada kanker ovarium tidak bermakna pada penelitian ini.
Kesimpulan: Stres oksidatif berperan dalam menekan ekspresi gen supresor tumor ARID1A ditingkat mRNA dan protein pada endometriosis.

Introduction: Endometriosis as a gynecologic benign lesion, can transform itself into cancer. Oxidative stress is considered as an important factor in endometriosis development. Studies found that ARID1A as tumor suppressor gene, was frequently mutated and inactivated in endometriosis associated ovarian cancer. The aim of the study is to analyze the role of oxidative stress on ARID1A expresion in endometriosis malignant transformation.
Methods: This study started with ten samples of ovarian cancer, ten samples of endometriosis, and 3 samples of eutopic endometrioid tissues as control. They were analyzed for the expression of ARID1A by RT-qPCR and ELISA, then analyzed for the activity of MnSOD as antioxidant enzyme and level of malondialdehyde as one of the oxidative stress damage effect evidence on cell's components. The second part of the study was experimental study on cultured eutopic endometrial and endometriosis cells. They were induced by H2O2 of 0, 100, and 1000 nM concentration. Analysis of the expression of ARID1A by RTqPCR and ELISA, and the DCFH-DA for the level of Reactive oxygen species were done.
Result: The impact of the H2O2 induction in repressing ARID1A gene expression on the endometriosis as well on the eutopic endometrium cells are significant, but not on the ovarian cancer in this study.
Conclusion: Oxidative stress has a role in repressing the expression of ARID1A gene at the mRNA and protein levels on the endometriosis.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2014
D-Pdf
UI - Disertasi Membership  Universitas Indonesia Library
cover
"Summary:
Experts from academia and both the biotechnology and pharmaceutical industries introduce biological, medical and methodological aspects of the emerging field of epigenomics."
Cambridge, UK: Cambridge Univ. Press, 2014
572.865 EPI
Buku Teks  Universitas Indonesia Library
cover
Lisawati Susanto
"ABSTRAK
Taxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis perneriksaan yang banyak dilakukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay/ELISA) untuk mendeteksi adanya zat anti IgG dan IgM terhadap T.gondii di dalam serum, namun pemeriksaan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplasmosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih.
Penelitian ini bertujuan untuk menentukan konsentrasi minimal DNA T.gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan target gen Bl dan gels P30 T.gondii.
PCR terhadap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk. dan Chang & Ho. Primer gen BI terdiri dari oligo 1 : 5'GGAACTGCATCCGTTCATGAG3' dan oligo 2 : 5'TCTTTAAAGCGTTCGTG GTC3'. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGOT-I ICGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'.
Pada penelitian ini, PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik, karena itu dilakukan juga PCR dengan metode menurut Chang & Ho. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gandii pada elektroforesis. Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi dengan menggunakan target gen B1 pada sampel DNA murai T.gondii adalah sebesar 0,1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat sebesar 1 pg, sedangkan pada darah manusia sehat yang dicampur dengan suspensi takizoit masih dapat terdeteksi sampai jumlah DNA dalam 1 takizoit. Dengan target gen P30 hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang rnasih terdeteksi pada sampel DNA murni T.gondtl adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dart pada sarnpel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit.
Dengan demikian dapat disimpulkan bahwa uji yang menggunakan target gin B1 lebih sensitif dibandingkan dengan gen P30.

ABSTRACT
Determination of Minimal Concentration of The DNA Toxoplasma gondii Which Still Can be Detected by The Polymerase Chain Reaction Using BI and P30 Genes.
Taxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. Serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice.
The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets.
The PCR against B1 gene as target was performed by using the method described by Chang & Ho, and described by Weiss et al and Chang & Ho against P30 gene as target. The B1 gene primers consisted of oligo 1 :5'GGAACFGCATCCGTTCATGAG3' and oligo 2 : 5'Te ITAAAGCGTTCGIGC3TC3', whereas the P30 gene primers consisted of oligo 1 5'CACACGGTTGTATGT'CGG ITI'CGCT3' and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3'.
It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al), therefore another PCR according to the method described by Chang & Ho was performed. In this method the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed.
The results obtained showed that the minimal DNA concentrations which still could be detected using B1 gene as target were as the following : 0.0001 ng DNA in 50 1~1 PCR solution from samples of pure DNA, 0.001 ng DNA 1 50 1.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 1 tachyzoite . Likewise, the minimal DNA concentrations which could still be detected using P30 as target gene were : 0.001 ng DNA in 50 tit PCR solution from samples ofpure DNA, 0.025 ng DNA in 501.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites.
It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.
"
Depok: Fakultas Kedokteran Universitas Indonesia, 2002
LP-pdf
UI - Laporan Penelitian  Universitas Indonesia Library
cover
Yurika Pramanan Diah
"Streptococcus pneumonia>e, bakteri patogen yang banyak menyebabkan infeksi sehingga menjadi penyakit pneumokokal yang memiliki morbiditas dan mortalitas tinggi. Antibiotik makrolid seperti eritromisin dan azitromisin merupakan pilihan terapi namun menunjukkan adanya peningkatan resistensi. Terdapat dua mekanisme utama timbulnya resistensi terhadap makrolid, yaitu metilasi ribosom yang diperankan oleh gen erm>(B) dan pompa efluks yang diperankan oleh gen mef>(A). Penelitian ini bertujuan untuk mendeteksi keberadaan gen erm>(B) dan mef>(A) pada isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin.
Sebanyak 60 isolat Streptococcus pneumoniae> diikutsertakan dalam penelitian ini. Uji kepekaan terhadap eritromisin dan azitromisin dilakukan dengan metode difusi cakram. Dari 60 isolat tersebut  didapatkan 33 (55 %) isolat sensitif sedangkan 27 (45 %) isolat resisten terhadap eritromisin dan azitromisin. Selanjutnya keberadaan gen erm>(B) dan mef>(A) dideteksi menggunakan PCR. Di antara 27 isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin, 7 (25,9 %) isolat memiliki gen erm>(B), 6 (22,2 %) isolat memiliki gen mef>(A), serta 14 (51,9 %) isolat memiliki kedua gen erm>(B) dan mef>(A). Dari 27 isolat tersebut, 11 ( 40,7 %) isolat merupakan serotipe 19 F, dan 9 ( 81,8 % ) isolat di antaranya memiliki kedua gen erm>(B) dan mef>(A). Hasil penelitian menunjukkan proporsi cukup besar baik dari gen erm>(B) atau mef>(A) saja maupun kedua gen secara bersamaan pada isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin. Sedangkan dari 15 isolat Streptococcus pneumoniae> yang peka terhadap eritromisin dan azitromisin tidak ditemukan gen erm>(B) dan mef>(A).

Streptococcus pneumoniae>, the leading pathogen of bacterial infection, is responsible for for pneumococcal diseases with severe morbidity and mortality. Macrolides ( e.g erythromycin and azithromycin ) has become drug of choice for pneumococcal diseases, but the prevalence of macrolides-resistant Streptococcus pneumoniae >have been rising in recent years. There are two major mechanisms mediating resistance to macrolides, >ribosomal methylation by >erm>(B) gene, and efflux pump by mef>(A) gene. The aims of this study is to detect erm>(B) and mef>(A) genes in erithromycin and azithromycin-resistant Streptococcus pneumoniae> isolates.
A total of 60 Streptococcus pneumoniae> isolates were analyzed using antimicrobial suscepbility test ( disk diffusion method ) to determine their drug resistance to erythromycin and azithromycin. Among 60 isolates, 33 (55 %) isolates were susceptible, and 27 (45 %) isolates were resistant to erythromycin and azithromycin. The presence of erm>(B) and mef>(A) was determined by PCR. Among of 27 erythromycin and azithromycin Streptococcus pneumonia>-resistant isolates, 7 (25,9 %) isolates carried erm>(B) gene, 6 (22,2 %) isolates carried mef>(A) genes, and 14 (51,9 %) isolates carried both erm>(B) and mef>(A) genes. Of these 27 isolates, 11 ( 40,7 %) isolates belongs to serotype 19 F, with 9 ( 81,8 %) isolates carried both erm>(B) and mef>(A) genes. In conclusion, there was a high proportion of either erm>(B) and mef>(A) genes alone or both of these genes in erythromycin and azithromycin-resistant Streptococcus pneumoniae> isolates. Of 15 erythromycin and azithromycin-susceptible Streptococcus pneumoniae> isolates, no erm>(B) and mef>(A) genes were found.
"
Depok: Fakultas Kedokteran Universitas Indonesia, 2018
T-pdf
UI - Tesis Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>