Hasil Pencarian  ::  Simpan CSV :: Kembali

Abstrak :
Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis pemeriksaan yang banyak dilakkukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay / ELISA) untuk medeteksi anti IgG dan Ig M terhadao T.gondii di dalam di dalam serum, namun pemeriksan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplamosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih. Penelitian ini bertujuan untuk menentukan konsentrai minimal DNA T. gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan targaet gen B1 dan gen P30 T. gondii. PCR terhdap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk dan aligo 2:5'TCTTTAAAAGCGTTCGTG GTC3' Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'. Pada penelitian ini PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk memberikan pita yang spesifik dan tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40, 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklur baru memberikan hasil pita spesifik T.gondii pada elektroforesis. Dapat disimpulkan bahwa uji yang menggunakan target gen B1 lebih sensitif dibandingkan dengan gen P30.

---

Toxoplasmagondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usuall performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is neede for diagnosing acute toxoplasmosis and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 gene as targets.

Abstrak :
ABSTRACT
Latar Belakang: Serotonin merupakan monoamine yang berperan sebagai neurotransmitter di sistem saraf pusat dan perifer. Penelitian terbaru menyatakan bahwa serotonin juga mempengaruhi fungsi sel T dan sel B. Serotonin transporter merupakan pusat regulasi sistem serotonergic dan menyebar diekspresikan pada sel-sel di sistem imun. Polimorfisme pada promotor gen serotonin transporter (5-HTTLPR) menunjukkan aspek genetic pada terjadinya depresi. Cheilitis angularis merupakan penyakit kompleks dengan keterlibatan faktor geneti. Adanya polimorfisme ini menyebabkan inflamasi pada penyakit cheilitis angularis yang dimediasi oleh sel T dan meningkatnya prevalensi depresi pada pasien cheilitis angularis. Tujuan: Mendeteksi adanya polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR) pada penderita cheilitis angulari. Metode: Analisis polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR) dilakukan dengan metode PCR-VNTR. Analisis statistic dilakukan dengan uji Chi-square. Hasil: Dalam penelitian ini, pada kelompok cheilitis angularis ditemukan 24 sampel dengan genotip SS, 23 sampel dengan genotip LS, dan 3 sampel dengan genotip LL. Sedangkan pada kelompok non-cheilitis angularis, ditemukan 5 sampel dengan genotip SS, 18 sampel dengan genotip LS, dan 27 sample dengan genotip LL. Pada kelompok cheilitis angularis ditemukan 71 alel S dan 29 alel L, dan pada kelompok non-cheilitis angularis ditemukan 28 alel S dan 72  alel L. Kesimpulan: Terdapat perbedaan bermakna pada distribusi polimorfisme gen Serotonin transporter SLC6A4 (5-HTTLPR)cheilitis angularis dengan non-cheilitis angularis (p = 0.001).

---

ABSTRACT
Serotonin is a monoamine acting as a neuromediator in the central and peripheral nervous system. Recently, serotonin has also been shown to influence T- and B-cell function. The serotonin transporter is central in the regulation of the serotonergic system and widely expressed on cells of the immune system. A functional length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) has been implicated in the genetic background of depression. Cheilitis angularis is a complex disease with a polygenetic inheritance. This polymorphism cause inflammation in cheilitis angularis mediated by the role of T cell and increased prevalence of depression in cheilitis angularis patients. To determine the relationship between the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism in cheilitis angularis patients in Indonesia. Analysis of the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism was observed by carrying out PCR method followed by electrophoresis for the analysis, without the usage of restriction enzyme. The chi-square test was used for statistical analysis. In this study, in the cheilitis angularis group there were 24 samples with SS genotype, 23 samples with LS genotype, and 3 samples with LL genotype. Whereas in the non-cheilitis angularis group, there were 5 samples with SS genotype, 18 samples with LS genotype, and 27 samples with LL genotype. In the cheilitis angularis group found 71 S alleles and 29 L alleles, and in the non-cheilitis angularis group 28 S alleles and 72 L alleles were found. There were significant differences in the distribution of the Serotonin transporter SLC6A4 (5-HTTLPR) gene polymorphism between cheilitis angularis and non-cheilitis angularis groups (p = 0.001). 

Abstrak :
Summary: Experts from academia and both the biotechnology and pharmaceutical industries introduce biological, medical and methodological aspects of the emerging field of epigenomics.

Abstrak :
Pendahuluan: Endometriosis merupakan suatu kelainan jinak ginekologi yang dapat mengalami transformasi menjadi kanker. Stres oksidatif diduga berperan dalam perkembangan penyakit endometriosis. Gen supresor tumor ARID1A banyak ditemukan termutasi dan inaktif pada kanker ovarium yang berhubungan dengan endometriosis. Tujuan penelitian adalah untuk menganalisis peran stres oksidatif terhadap ekspresi gen supresor tumor ARID1A dalam transformasi endometriosis menjadi ganas. Metoda: Penelitian dimulai dengan 10 sampel jaringan kanker ovarium, 10 sampel endometriosis dan3 jaringan endometrium eutopik sebagai kontrol yang diisolasi mRNA dan proteinnya. Analisis ekspresi gen ARID1A pada tingkat mRNA dilakukan dengan pemeriksaan RT-qPCR dan pada tingkat protein dengan ELISA. Pada sel endometriosis dan kanker ovarium dilakukan analisis stres oksidatif dengan pemeriksaan aktivitas antioksidan MnSOD dan pemeriksaan kadar MDA sebagai salah bukti kerusakan salah satu komponen sel. Setelah itu dilakukan uji eksperimental pada kultur sel endometriosis dan endometrium eutopik sebagai kontrol. Kedua sel kultur diinduksi dengan H2O2 konsentrasi 0 nM, 100 nM, dan 1000 nM. Analisis dilakukan terhadap ketahanan hidup sel, kadar ROS dan ekspresi gen ARID1A pada tingkat mRNA dan protein. Hasil: Efek induksi H2O2 dalam menekan ekspresi gen ARID1A sel endometriosis dan sel endometrium eutopik pada tingkat mRNA dan protein, bermakna, meskipun pada kanker ovarium tidak bermakna pada penelitian ini. Kesimpulan: Stres oksidatif berperan dalam menekan ekspresi gen supresor tumor ARID1A ditingkat mRNA dan protein pada endometriosis. ...... Introduction: Endometriosis as a gynecologic benign lesion, can transform itself into cancer. Oxidative stress is considered as an important factor in endometriosis development. Studies found that ARID1A as tumor suppressor gene, was frequently mutated and inactivated in endometriosis associated ovarian cancer. The aim of the study is to analyze the role of oxidative stress on ARID1A expresion in endometriosis malignant transformation. Methods: This study started with ten samples of ovarian cancer, ten samples of endometriosis, and 3 samples of eutopic endometrioid tissues as control. They were analyzed for the expression of ARID1A by RT-qPCR and ELISA, then analyzed for the activity of MnSOD as antioxidant enzyme and level of malondialdehyde as one of the oxidative stress damage effect evidence on cell's components. The second part of the study was experimental study on cultured eutopic endometrial and endometriosis cells. They were induced by H2O2 of 0, 100, and 1000 nM concentration. Analysis of the expression of ARID1A by RTqPCR and ELISA, and the DCFH-DA for the level of Reactive oxygen species were done. Result: The impact of the H2O2 induction in repressing ARID1A gene expression on the endometriosis as well on the eutopic endometrium cells are significant, but not on the ovarian cancer in this study. Conclusion: Oxidative stress has a role in repressing the expression of ARID1A gene at the mRNA and protein levels on the endometriosis.

Abstrak :
Streptococcus pneumonia>e, bakteri patogen yang banyak menyebabkan infeksi sehingga menjadi penyakit pneumokokal yang memiliki morbiditas dan mortalitas tinggi. Antibiotik makrolid seperti eritromisin dan azitromisin merupakan pilihan terapi namun menunjukkan adanya peningkatan resistensi. Terdapat dua mekanisme utama timbulnya resistensi terhadap makrolid, yaitu metilasi ribosom yang diperankan oleh gen erm>(B) dan pompa efluks yang diperankan oleh gen mef>(A). Penelitian ini bertujuan untuk mendeteksi keberadaan gen erm>(B) dan mef>(A) pada isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin. Sebanyak 60 isolat Streptococcus pneumoniae> diikutsertakan dalam penelitian ini. Uji kepekaan terhadap eritromisin dan azitromisin dilakukan dengan metode difusi cakram. Dari 60 isolat tersebut  didapatkan 33 (55 %) isolat sensitif sedangkan 27 (45 %) isolat resisten terhadap eritromisin dan azitromisin. Selanjutnya keberadaan gen erm>(B) dan mef>(A) dideteksi menggunakan PCR. Di antara 27 isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin, 7 (25,9 %) isolat memiliki gen erm>(B), 6 (22,2 %) isolat memiliki gen mef>(A), serta 14 (51,9 %) isolat memiliki kedua gen erm>(B) dan mef>(A). Dari 27 isolat tersebut, 11 ( 40,7 %) isolat merupakan serotipe 19 F, dan 9 ( 81,8 % ) isolat di antaranya memiliki kedua gen erm>(B) dan mef>(A). Hasil penelitian menunjukkan proporsi cukup besar baik dari gen erm>(B) atau mef>(A) saja maupun kedua gen secara bersamaan pada isolat Streptococcus pneumoniae> yang resisten terhadap eritromisin dan azitromisin. Sedangkan dari 15 isolat Streptococcus pneumoniae> yang peka terhadap eritromisin dan azitromisin tidak ditemukan gen erm>(B) dan mef>(A). ......Streptococcus pneumoniae>, the leading pathogen of bacterial infection, is responsible for for pneumococcal diseases with severe morbidity and mortality. Macrolides ( e.g erythromycin and azithromycin ) has become drug of choice for pneumococcal diseases, but the prevalence of macrolides-resistant Streptococcus pneumoniae >have been rising in recent years. There are two major mechanisms mediating resistance to macrolides, >ribosomal methylation by >erm>(B) gene, and efflux pump by mef>(A) gene. The aims of this study is to detect erm>(B) and mef>(A) genes in erithromycin and azithromycin-resistant Streptococcus pneumoniae> isolates. A total of 60 Streptococcus pneumoniae> isolates were analyzed using antimicrobial suscepbility test ( disk diffusion method ) to determine their drug resistance to erythromycin and azithromycin. Among 60 isolates, 33 (55 %) isolates were susceptible, and 27 (45 %) isolates were resistant to erythromycin and azithromycin. The presence of erm>(B) and mef>(A) was determined by PCR. Among of 27 erythromycin and azithromycin Streptococcus pneumonia>-resistant isolates, 7 (25,9 %) isolates carried erm>(B) gene, 6 (22,2 %) isolates carried mef>(A) genes, and 14 (51,9 %) isolates carried both erm>(B) and mef>(A) genes. Of these 27 isolates, 11 ( 40,7 %) isolates belongs to serotype 19 F, with 9 ( 81,8 %) isolates carried both erm>(B) and mef>(A) genes. In conclusion, there was a high proportion of either erm>(B) and mef>(A) genes alone or both of these genes in erythromycin and azithromycin-resistant Streptococcus pneumoniae> isolates. Of 15 erythromycin and azithromycin-susceptible Streptococcus pneumoniae> isolates, no erm>(B) and mef>(A) genes were found.

Abstrak :
Latar belakang: Sindrom ovarium polikistik (SOPK) merupakan salah satu kelainan endokrin paling umum pada 7-15% wanita usia reproduksi yang menyebabkan infertilitas anovulatori. SOPK sering ditemukan pada wanita gemuk, sekitar 50-75% tetapi sindrom ini juga dapat ditemukan pada wanita kurus sebesar 5,5%. Penyebab dan patogenesis SOPK sampai sekarang masih diperdebatkan tapi hasil penelitian memperlihatkan hiperandrogen dan resistensi insulin terlibat dalam perkembangan perjalanan penyakit dan fenotip SOPK. Efek androgen dimediasi oleh reseptor androgen (AR) sedangkan efek insulin dimediasi oleh reseptor insulin (INSR). Ekspresi dan aksi dari kedua reseptor ini terutama pada sel granulosa ovarium dapat dipengaruhi oleh mekanisme epigenetik yang diduga terlibat dalam perkembangan penyakit SOPK ini. Tujuan: Mengetahui tingkat metilasi DNA pada gen reseptor androgen (AR) dan reseptor insulin (INSR) serta ekspresi mRNAnya pada sel granulosa subjek SOPK dan nir-SPOK. Metode: Penelitian ini merupakan penelitian deskriptif analitik dengan rancangan cross sectional. Sampel berupa sel granulosa dari folikel ovarium didapatkan dari wanita yang melakukan ovum pick up (OPU) di klinik Yasmin RSUPN Ciptomangunkusumo yang kemudian dilakukan isolasi DNA dan RNA. Pada isolat DNA dilakukan konversi bisulfit, Methyl Specifik PCR (MSP), elektroforesis dan analisis ketebalan pita dengan perangkat lunak ImageJ untuk mendapatkan data tingkat metilasi DNA. Pada isolat RNA dilakukan qPCR untuk mendapatkan ekspresi relatif mRNA gen AR dan INSR. Hasil: Analisis data dari 21 subjek SOPK dan 20 subjek nir SOPK menunjukkan terdapat perbedaan bermakna (p=0,00) tingkat metilasi DNA gen AR pada pasien SOPK (45.24 %±16,84) dibandingkan nir-SOPK (84,96±15,45). Analisis gen INSR, pada subjek SOPK 100% tidak terjadi metilasi pada promotor gen INSR tetapi pada subjek nir-SOPK 1 dari 21 wanita mengalami metilasi parsial ((37,82%±8,25). Dari penelitian juga didapatkan terjadinya peningkatan ekspresi relatif mRNA AR sebesar 2,459 kali dan 1,791 kali pada mRNA INSR. Tidak terdapat korelasi antara tingkat metilasi gen AR dan INSR dengan ekspresi mRNAnya. Kesimpulan: Penurunan tingkat metilasi DNA (hipometilasi) pada gen AR dan INSR dapat meningkatkan tingkat ekspresi mRNA AR dan INSR, yang kemudian berkontribusi terhadap kejadian hiperandrogen dan resistensi insulin pada fenotip subjek SOPK. ......Background: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in 7-15% of women of reproductive age who cause anovulatory infertility. PCOS is often found in obese women, around 50-75% but this syndrome can also be found in thin women at 5.5%. The causes and pathogenesis of PCOS is still debated but the results of the study show hyperandrogen and insulin resistance involved in the development of the disease course and the PCOS phenotype. The androgen effect is mediated by the androgen receptor (AR) while the effect of insulin is mediated by the insulin receptor (INSR). The expression and action of these two receptors, especially in ovarian granulosa cells can be influenced by epigenetic mechanisms that are thought to be involved in the development of PCOS. Objective: To determine the level of DNA methylation in the androgen receptor gene (AR) and insulin receptor (INSR) and its mRNA expression in the SOPK and nir-SPOK granulosa cells. Method: This study is a descriptive analytic study with a cross sectional design. Samples in the form of granulosa cells from ovarian follicles were obtained from women who performed ovum pick up (OPU) at the Yasmin clinic Ciptomangunkusumo Hospital which was then isolated from DNA and RNA. DNA isolates were carried out bisulfite conversion, Methyl Specific PCR (MSP), electrophoresis and tape thickness analysis with ImageJ software to obtain DNA methylation level data. QPCR was performed on RNA isolates to obtain the relative expression of the AR and INSR mRNA genes. Results: Analysis of data from 21 SOPK subjects and 20 non-PCOS subjects showed significant differences (p = 0.00) of AR gene DNA methylation rates in PCOS patients (45.24% ± 16.84) compared to non-PCOS (84.96 ± 15 , 45). INSR gene analysis, in the subject of 100% PCOS there was no methylation of the INSR gene promoter but in non-PCOS subjects 1 out of 21 women had partial methylation ((37.82% ± 8.25). AR is 3.459 times and 2.791 times in INSR mRNA. There is no correlation between the rate of methylation of the AR and INSR genes with their mRNA expression. Conclusion: Decreasing levels of DNA methylation (hypomethylation) in AR and INSR genes can increase the level of expression of mRNA AR and INSR, which then contributes to the incidence of hyperandrogen and insulin resistance in the phenotype of the PCOS subject.