Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 169997 dokumen yang sesuai dengan query
cover
Endang Rahmawati
"Lesi fokal otak merupakan komplikasi neurologi pada pasien HIV yang ditandai oleh lesi desak ruang (Space Occupying Lesion) yang membutuhkan penanganan cepat dan tepat. Di beberapa negara, lesi ini dapat disebabkan oleh toksoplasma ensefalitis dan limfoma otak primer. Lesi yang disebabkan oleh toksoplasmosis dan limfoma otak primer yang disebabkan oleh Epstein Barr virus sulit untuk dibedakan menggunakan CT scan ataupun MRI. Pemeriksaan gold standar untuk membedakan keduanya yaitu dengan biopsi otak, namun hal ini merupakan tindakan invasif dan dapat menimbulkan komplikasi. Penelitian ini bertujuan untuk memperoleh uji deteksi untuk diagnosis cepat infeksi Toxoplasma gondii dan Epstein Barr virus. Desain yang dipakai pada penelitian adalah studi eksperimental laboratorium. Uji deteksi yang dikembangkan adalah dupleks real-time PCR yang dapat mendeteksi T.gondii dan EBV atau kombinasi keduanya dalam satu reaksi pada sampel pasien HIV dengan gejala klinis tersangka infeksi otak. Tahap pertama dilakukan optimasi dupleks real-time PCR meliputi suhu annealing, konsentrasi primer dan probe, uji volume elusi dan volume cetakan. Penentuan ambang batas deteksi dilakukan untuk mengukur minimal T.gondii dan EBV yang dapat dideteksi. Reaksi silang untuk mengetahui spesifisitas teknik dilakukan menggunakan bakteri dan virus sebagai berikut Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, dan Varicella zoster virus. Dupleks real-time PCR yang telah optimal diaplikasi pada sampel pasien. Sampel yang digunakan adalah darah dan cairan serebrospinal dari pasien HIV dengan gejala klinis infeksi otak yang dirawat di bagian neurologi RSCM. Hasil optimasi dupleks real-time PCR diperoleh suhu annealing untuk T.gondii dan EBV 58°C, konsentrasi primer forward dan reverse untuk T.gondii dan EBV adalah 0,2 µM, konsentrasi probe T.gondii 0,4µM, konsentrasi probe EBV 0,2 µM. Deteksi ambang batas minimal DNA untuk T.gondii 5,68 copy /ml, sedangkan EBV 1,31 copy/ml. Uji yang dikembangkan pada penelitian ini termasuk uji yang sensitif dibandingkan hasil penelitian lain. Uji reaksi silang primer dan probe dupleks real-time PCR terhadap beberapa bakteri dan virus lain, menunjukkan tidak bereaksi silang dengan primer dan probe yang digunakan untuk mendeteksi T.gondii dan EBV. Hasil pemeriksaan dupleks real-time PCR pada sampel darah diperoleh 16% positif T.gondii, 40% positif Epstein Barr virus, sebanyak 16% positif Epstein Barr virus dan T.gondii dan pada sampel cairan serebrospinal diperoleh hasil 20% positif T.gondii, sebanyak 28% positif Epstein Barr virus dan 4% positif terhadap Epstein Barr Virus dan T.gondii.

Focal brain lesion is neurology complication in HIV that marked with Space Occupying Lesion (SOL), that need rapid and effective handling. In most country, this lesion could be cause by encephalitis toxoplasma and Primary Central Nervous System Lymphoma that related to Epstein Barr virus infection that was difficult to distinguished using CT scan or MRI. Gold standard to distinguished was brain biopsy, but this examination was invasive procedure that cause complication. Therefore, we need a reliable and rapid examination to distinguished it. This study aimed to get detection for rapid diagnosis of T.gondii and EBV infection. This study was an experimental laboratory. First step was optimation of dupleks real-time PCR include annealing temperature, primer andprobe consentration, elution volume and template volume. Minimal detection of DNA to measured minimal T.gondii and EBV that could be detected. Cross reaction to know technique spesivisity using bacterial and virus Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, and Varicella zoster virus. Dupleks real-time PCR has been optimally applied to patient. The sample from blood and cerebrospinal fluid of HIV patients who admitted in the neurology department of RSCM then examined to duplex real-time PCR to detect T.gondii and EBV. The optimation of duplex real-time PCR, the annealing temperature for T.gondii and EBV were 58°C, consentration of primer forward and reverse for T.gondii and EBV were 0,2 µM, consentration of probe for T.gondii was 0,4µM and EBV was 0,2µM.. Minimal DNA detection for T.gondii was 5,68 copy/ml and EBV was 1,31 copy /ml. This study was sensitive like the others. Spesivisity technique of real-time PCR, there was not cross reaction between another bacteria and virus that used as primer and probe for T.gondii and EBV. From the results of the duplex real-time PCR on blood samples, 16 % was positive T.gondii, 40% Epstein Barr virus, and 16% were positive Epstein Barr virus and T.gondii and from cerebrospinal fluid samples 20% was positive T.gondii, 28% was positive Epstein Barr virus and 4% were positive for Epstein Barr Virus and T.gondii."
Depok: Fakultas Kedokteran Universitas Indonesia, 2015
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Endang Rahmawati
"ABSTRAK
Lesi fokal otak merupakan komplikasi neurologi pada pasien HIV yang ditandai oleh lesi desak ruang (Space Occupying Lesion) yang membutuhkan penanganan cepat dan tepat. Di beberapa negara, lesi ini dapat disebabkan oleh toksoplasma ensefalitis dan limfoma otak primer. Lesi yang disebabkan oleh toksoplasmosis dan limfoma otak primer yang disebabkan oleh Epstein Barr virus sulit untuk dibedakan menggunakan CT scan ataupun MRI. Pemeriksaan gold standar untuk membedakan keduanya yaitu dengan biopsi otak, namun hal ini merupakan tindakan invasif dan dapat menimbulkan komplikasi. Penelitian ini bertujuan untuk memperoleh uji deteksi untuk diagnosis cepat infeksi Toxoplasma gondii dan Epstein Barr virus. Desain yang dipakai pada penelitian adalah studi eksperimental laboratorium. Uji deteksi yang dikembangkan adalah dupleks real-time PCR yang dapat mendeteksi T.gondii dan EBV atau kombinasi keduanya dalam satu reaksi pada sampel pasien HIV dengan gejala klinis tersangka infeksi otak. Tahap pertama dilakukan optimasi dupleks real-time PCR meliputi suhu annealing, konsentrasi primer dan probe, uji volume elusi dan volume cetakan. Penentuan ambang batas deteksi dilakukan untuk mengukur minimal T.gondii dan EBV yang dapat dideteksi. Reaksi silang untuk mengetahui spesifisitas teknik dilakukan menggunakan bakteri dan virus sebagai berikut Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, dan Varicella zoster virus. Dupleks real-time PCR yang telah optimal diaplikasi pada sampel pasien. Sampel yang digunakan adalah darah dan cairan serebrospinal dari pasien HIV dengan gejala klinis infeksi otak yang dirawat di bagian neurologi RSCM. Hasil optimasi dupleks real-time PCR diperoleh suhu annealing untuk T.gondii dan EBV 58°C, konsentrasi primer forward dan reverse untuk T.gondii dan EBV adalah 0,2 µM, konsentrasi probe T.gondii 0,4µM, konsentrasi probe EBV 0,2 µM. Deteksi ambang batas minimal DNA untuk T.gondii 5,68 copy /ml, sedangkan EBV 1,31 copy/ml. Uji yang dikembangkan pada penelitian ini termasuk uji yang sensitif dibandingkan hasil penelitian lain. Uji reaksi silang primer dan probe dupleks real-time PCR terhadap beberapa bakteri dan virus lain, menunjukkan tidak bereaksi silang dengan primer dan probe yang digunakan untuk mendeteksi T.gondii dan EBV. Hasil pemeriksaan dupleks real-time PCR pada sampel darah diperoleh 16% positif T.gondii, 40% positif Epstein Barr virus, sebanyak 16% positif Epstein Barr virus dan T.gondii dan pada sampel cairan serebrospinal diperoleh hasil 20% positif T.gondii, sebanyak 28% positif Epstein Barr virus dan 4% positif terhadap Epstein Barr Virus dan T.gondii. ABSTRACT
Focal brain lesion is neurology complication in HIV that marked with Space Occupying Lesion (SOL), that need rapid and effective handling. In most country, this lesion could be cause by encephalitis toxoplasma and Primary Central Nervous System Lymphoma that related to Epstein Barr virus infection that was difficult to distinguished using CT scan or MRI. Gold standard to distinguished was brain biopsy, but this examination was invasive procedure that cause complication. Therefore, we need a reliable and rapid examination to distinguished it. This study aimed to get detection for rapid diagnosis of T.gondii and EBV infection. This study was an experimental laboratory. First step was optimation of dupleks real-time PCR include annealing temperature, primer andprobe consentration, elution volume and template volume. Minimal detection of DNA to measured minimal T.gondii and EBV that could be detected. Cross reaction to know technique spesivisity using bacterial and virus Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, and Varicella zoster virus. Dupleks real-time PCR has been optimally applied to patient. The sample from blood and cerebrospinal fluid of HIV patients who admitted in the neurology department of RSCM then examined to duplex real-time PCR to detect T.gondii and EBV. The optimation of duplex real-time PCR, the annealing temperature for T.gondii and EBV were 58°C, consentration of primer forward and reverse for T.gondii and EBV were 0,2 µM, consentration of probe for T.gondii was 0,4µM and EBV was 0,2µM.. Minimal DNA detection for T.gondii was 5,68 copy/ml and EBV was 1,31 copy /ml. This study was sensitive like the others. Spesivisity technique of real-time PCR, there was not cross reaction between another bacteria and virus that used as primer and probe for T.gondii and EBV. From the results of the duplex real-time PCR on blood samples, 16 % was positive T.gondii, 40% Epstein Barr virus, and 16% were positive Epstein Barr virus and T.gondii and from cerebrospinal fluid samples 20% was positive T.gondii, 28% was positive Epstein Barr virus and 4% were positive for Epstein Barr Virus and T.gondii.;Focal brain lesion is neurology complication in HIV that marked with Space Occupying Lesion (SOL), that need rapid and effective handling. In most country, this lesion could be cause by encephalitis toxoplasma and Primary Central Nervous System Lymphoma that related to Epstein Barr virus infection that was difficult to distinguished using CT scan or MRI. Gold standard to distinguished was brain biopsy, but this examination was invasive procedure that cause complication. Therefore, we need a reliable and rapid examination to distinguished it. This study aimed to get detection for rapid diagnosis of T.gondii and EBV infection. This study was an experimental laboratory. First step was optimation of dupleks real-time PCR include annealing temperature, primer andprobe consentration, elution volume and template volume. Minimal detection of DNA to measured minimal T.gondii and EBV that could be detected. Cross reaction to know technique spesivisity using bacterial and virus Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, and Varicella zoster virus. Dupleks real-time PCR has been optimally applied to patient. The sample from blood and cerebrospinal fluid of HIV patients who admitted in the neurology department of RSCM then examined to duplex real-time PCR to detect T.gondii and EBV. The optimation of duplex real-time PCR, the annealing temperature for T.gondii and EBV were 58°C, consentration of primer forward and reverse for T.gondii and EBV were 0,2 µM, consentration of probe for T.gondii was 0,4µM and EBV was 0,2µM.. Minimal DNA detection for T.gondii was 5,68 copy/ml and EBV was 1,31 copy /ml. This study was sensitive like the others. Spesivisity technique of real-time PCR, there was not cross reaction between another bacteria and virus that used as primer and probe for T.gondii and EBV. From the results of the duplex real-time PCR on blood samples, 16 % was positive T.gondii, 40% Epstein Barr virus, and 16% were positive Epstein Barr virus and T.gondii and from cerebrospinal fluid samples 20% was positive T.gondii, 28% was positive Epstein Barr virus and 4% were positive for Epstein Barr Virus and T.gondii.;Focal brain lesion is neurology complication in HIV that marked with Space Occupying Lesion (SOL), that need rapid and effective handling. In most country, this lesion could be cause by encephalitis toxoplasma and Primary Central Nervous System Lymphoma that related to Epstein Barr virus infection that was difficult to distinguished using CT scan or MRI. Gold standard to distinguished was brain biopsy, but this examination was invasive procedure that cause complication. Therefore, we need a reliable and rapid examination to distinguished it. This study aimed to get detection for rapid diagnosis of T.gondii and EBV infection. This study was an experimental laboratory. First step was optimation of dupleks real-time PCR include annealing temperature, primer andprobe consentration, elution volume and template volume. Minimal detection of DNA to measured minimal T.gondii and EBV that could be detected. Cross reaction to know technique spesivisity using bacterial and virus Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, Cytomegalo virus, Herpes zoster virus, and Varicella zoster virus. Dupleks real-time PCR has been optimally applied to patient. The sample from blood and cerebrospinal fluid of HIV patients who admitted in the neurology department of RSCM then examined to duplex real-time PCR to detect T.gondii and EBV. The optimation of duplex real-time PCR, the annealing temperature for T.gondii and EBV were 58°C, consentration of primer forward and reverse for T.gondii and EBV were 0,2 µM, consentration of probe for T.gondii was 0,4µM and EBV was 0,2µM.. Minimal DNA detection for T.gondii was 5,68 copy/ml and EBV was 1,31 copy /ml. This study was sensitive like the others. Spesivisity technique of real-time PCR, there was not cross reaction between another bacteria and virus that used as primer and probe for T.gondii and EBV. From the results of the duplex real-time PCR on blood samples, 16 % was positive T.gondii, 40% Epstein Barr virus, and 16% were positive Epstein Barr virus and T.gondii and from cerebrospinal fluid samples 20% was positive T.gondii, 28% was positive Epstein Barr virus and 4% were positive for Epstein Barr Virus and T.gondii."
Fakultas Kedokteran Universitas Indonesia, 2016
SP-PDF
UI - Tugas Akhir  Universitas Indonesia Library
cover
Dede Sulaeman
"Latar belakang: Kanker nasofaring merupakan keganasan yang unik dimana angka kejadiannya termasuk jarang disebagian besar negara, namun endemis di wilayah tiongkok selatan, dan asia tenggara termasuk Indonesia. Histopatologi kanker nasofaring di daerah endemik biasanya merupakan karsinoma jenis tidak berkeratin tidak berdiferensiasi dan selalu terkait dengan infeksi EBV. Berbagai jenis protein virus diekspresikan pada infeksi laten EBV termasuk EBNA1 dan LMP1 mungkin berkontribusi dalam perkembangan kanker. Oleh karenanya, kami ingin menginvestigasi peran onkoprotein virus tersebut terhadap agresivitas dan respon terapi kanker nasofaring.
Metode: Spesimen biopsi jaringan dan darah yang diambil dari pasien kanker nasofaring diukur kadar EBNA1 dan LMP1 dengan menggunakan pemeriksaan ELISA kit masing-masing dari DRG® dan MyBioSource® kemudian dikorelasikan dengan voume tumor dan KGB terlibat yang dinilai berdasarkan delineasi berbasis pencitraan 3D. Pasien kemudian menjalani terapi standar, dan dilakukan penilaian 3 bulan paska terapi. Respon terapi akan dinilai hubungannya dengan kadar EBNA1 dan LMP1.
Hasil: 23 subjek dimasukan kedalam studi, 69,5% berada pada stadium IVA keatas, dengan mayoritas laki-laki sebanyak 61%. Median volume tumor primer dan volume KGB masing masing 41,4cc (13,2-128,8) dan 40,1cc (1,2-633,5). Uji korelasi Spearman mendapatkan hubungan bermakna (p=0,032) antara kadar LMP1 jaringan dan volume tumor sebelum terapi (r=0,448). Tren korelasi yang moderat terlihat pada kadar EBNA1 di jaringan dengan di darah, kadar EBNA1 di jaringan dengan volume tumor primer, kadar EBNA1 di darah dengan volume KGB, serta Kadar LMP1 baik di jaringan maupun di darah dengan volume KGB, meskipun secara keseluruhan tidak bermakna secara statistik. Sementara itu, pengaruh kadar LMP1 dan EBNA1 terhadap respon terapi belum dapat disimpulkan.
Kesimpulan: Semakin tinggi kadar LMP1 di jaringan tumor akan diikuti oleh semakin besarnya volume tumor primer nasofaring. Korelasi moderat tidak signifikan pada variabel lain mungkin diakibatkan oleh jumlah sampel yang kurang. Penambahan besar sampel diperlukan untuk konfirmasi signifikansi dari korelasi tersebut.

Background: Nasopharyngeal cancer is an unique malignancy where the incidence is rare in most countries but endemic in Southern China and Southeast Asia, including Indonesia. The histopathology of nasopharyngeal cancer in endemic areas is usually an undifferentiated nonkeratinizing type carcinoma and is always associated with EBV infection. Various viral proteins are expressed in latent EBV infection, including EBNA1 and LMP1. These viral oncoproteins may contribute to cancer development, but they are not always be defined. Therefore, we want to investigate the role of these viral oncoproteins when it comes to the aggressivity and treatment response of nasopharyngeal cancer.
Methods: Tissue biopsy and blood specimens taken from nasopharyngeal cancer patients were measured for EBNA1 and LMP1 using the ELISA kit examination from DRG® and MyBioSource® respectively, then correlated with primary tumor and nodal volume, which was calculated by delineation based on 3D imaging. Patients then underwent standard therapy, and was assessed 3 months post-therapy. Response to therapy will be assessed in relation to levels of EBNA1 and LMP1.
Results: 23 subjects were included in the study, 69.5% was at stage IVA and above with the majority being males (61%). The median primary tumor and lymph node volume were 41.4cc (13.2-128.8) and 40.1cc(1,2-633.5), respectively. Spearman correlation test found a significant relationship (p=0.032) between tissue LMP1 levels and tumor volume before therapy (r=0.448). A moderate correlation trend was seen in EBNA1 levels in tissue with blood, EBNA1 levels in tissue with primary tumor volume, EBNA1 levels in blood with lymph node volume, and LMP1 levels both in tissue and in blood with lymph node volume, although overall it was not statistically significant. Meanwhile, the effect of LMP1 and EBNA1 levels on the response to therapy cannot be concluded.
Conclusion: The higher the level of LMP1 in the tumor tissue, the larger the volume of primary nasopharyngeal tumor will be. Moderately insignificant correlation on the other variables may be caused by a small number of samples. The addition of the sample size is needed to confirm the significance of the correlation.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2021
SP-pdf
UI - Tugas Akhir  Universitas Indonesia Library
cover
Imelda Masrin
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2006
T58780
UI - Tesis Membership  Universitas Indonesia Library
cover
Chaerita Maulani
"Periodontitis merupakan penyakit inflamasi kronis dengan etiologi umum yaitu plak dan bakteri. Virus merupakan mikroorganisme yang diduga turut berperan dalam etiologi
periodontitis. Faktor genetik yaitu polimorfisme IFN-γ +874T/A (rs2430561) juga dapat mempengaruhi kerentanan seseorang terhadap periodontitis. Kadar IFN-γ sebagai salah satu respon host terhadap virus, dapat meningkat pada subjek dengan periodontitis. Faktor prediksi periodontitis yang telah dikenal berperan dalam etiologi periodontitis adalah faktor sosiodemografis (usia, jenis kelamin), parameter klinis (body mass index (BMI), merokok dan kebersihan mulut). Polimorfisme +874T/A (rs2430561) diduga mempengaruhi kadar IFN-γ. Tujuan: menganalisis hubungan antara virus Epstein-Barr (VEB), polimorfisme gen interferon gamma (IFN-γ +874T/A (rs2430561), kadar IFN-γ,
sosiodemografis dan parameter klinis dengan periodontitis dan mendapatkan indeks prediksi periodontitis. Tujuan kedua adalah mengetahui hubungan antara polimorfisme
IFN-γ dengan kadar IFN-γ. Metode: Evaluasi dilakukan pada 136 subjek yang dilakukan pemeriksaan klinis jaringan periodontal yang telah memenuhi kriteria inklusi. Cairan
krevikular gingiva (CGK) diperiksa dengan paper point kemudian dilakukan analisis kadar IFN-γ dengan metode ELISA dan dilakukan ekstraksi DNA dan diperiksa DNA VEB
dengan metode qRT-PCR. Ekstraksi DNA dari darah perifer subjek kemudian dianalisis genotipnya dengan menggunakan teknik RFLP. Data sosiodemografis (usia, jenis kelamin) dan parameter klinis (BMI, merokok dan kebersihan mulut) diperiksa dan dianalisis. Uji multivariat regresi logistik dilakukan untuk memperoleh faktor yang paling berperan pada periodontitis. Hasil: Tidak ditemukan hubungan bermakna antara VEB dengan periodontitis (p>0,05), namun deteksi VEB lebih banyak ditemukan pada periodontitis sedang-berat dibanding periodontitis ringan. Polimorfisme IFN-γ +874T/A (rs2430561) genotip AT atau TT mempunyai hubungan bermakna dengan periodontitis (OR=2,70; p=0,036) dibandingkan dengan genotip AA. Hubungan bermakna ditemukan pada kadar IFN-γ (OR=2,87; p=0,034), jenis kelamin (OR=0,04; p< 0,001) dan kebersihan mulut (OR 9,03, p=0,002) dengan periodontitis. Hubungan polimorfisme
IFN-γ +874T/A (rs2430561) dengan kadar IFN-γ ditemukan tidak bermakna (p>0,05).
Kesimpulan: Indeks prediksi periodontitis model satu didapatkan faktor prediksi jenis kelamin, kebersihan mulut, kadar IFN-γ dan polimorfisme +874T/A (rs2430561) yang mempengaruhi periodontitis. Indeks prediksi model dua didapatkan faktor prediksi jenis kelamin, kebersihan mulut dan kadar IFN-γ sebagai indeks prediksi periodontitis yang
lebih aplikatif. Polimorfisme IFN-γ +874T/A (rs2430561) tidak mempengaruhi kadar IFN-γ pada subjek periodontitis.

Periodontitis is a chronic inflammatory disease of periodontium that has a multifactorial origin. Dental plaque and bacteria widely known as the main etiology in periodontitis Viruses are microorganisms that are thought to play a role in the etiology of periodontitis. The IFN-γ genetic polymorphisms may cause an alteration in host immune response. IFN-γ cytokine has important roles toward virus and intracellular bacteria and the level of IFN-
γ increased in periodontitis patients. Sociodemographic factors (age, gender), clinical parameters (body mass index (BMI), smoking, and oral hygiene) are associated with the increased risk and severity of periodontitis. The polymorphisms of IFN-γ +874T/A (rs2430561) may affect the production of IFN-γ. Objective: to analyze the relationship between Epstein-Barr virus (EBV), interferon-gamma (IFN-γ) gene polymorphism +874T/A (rs2430561), IFN-γ levels, sociodemographic and clinical parameters with
periodontitis and obtain a predictive index of periodontitis. The second objective was to determine the relationship between IFN-γ polymorphisms and IFN-γ levels. Methods: A total of 136 subjects who met the inclusion criteria were invited to participate in the study.
Periodontal status was assessed by pocket depth, clinical attachment loss, and number of teeth. The IFN-γ level obtained from gingival crevicular fluid were measured using Human IFN-γ ELISA kit. EBV DNA positivity was determined in GCF samples using quantitative real-time PCR. DNA for single-nucleotide polymorphism (SNP) genotyping was extracted from the peripheral blood and the genotype was analyzed using the RFLP technique. Sociodemographic data and clinical parameters were examined and analyzed. Multivariate logistic regression analysis was performed to identify predictors associated
with periodontitis. Results: The association between EBV and periodontitis was not significant (p>0,05), but the positive EBV detection was found higher in moderate-severe
periodontitis than mild periodontitis. Statistically significant differences were found in IFN-γ +874T/A (rs2430561) polymorphism between genotype AA, AT, TT, and the protein expressions of severe and mild periodontitis samples (OR 2.70, p=0.036; OR 2.87, p=0.034, respectively). Gender and oral hygiene were showed significantly difference (OR 0.04, p < 0.001; OR 9.03, p = 0.002, respectively). The +874T/A (rs2430561)
polymorphism association with IFN-γ levels was not significant (p>0.05). Conclusion: The final predictive index of periodontitis consists of gender, oral hygiene, IFN-γ levels, and polymorphism +874T/A (rs2430561). The second model consists of gender, oral hygiene and IFN-γ levels which were more applicable in less lab facility. The +874T/A (rs2430561) polymorphism did not affect IFN-γ levels in periodontitis subjects.
"
Depok: Fakultas Kedokteran Gigi Universitas Indonesia, 2021
D-pdf
UI - Disertasi Membership  Universitas Indonesia Library
cover
Stefanus Sutopo
"ABSTRACT
Kanker serviks adalah salah satu penyakit malignansi yang cukup berbahaya, dengan 500.000 kejadian baru dan 240.000 kematian setiap tahunnya. Walau etiologi intinya, human papillomavirus (HPV), telah diketahui sejak tahun 1990-an, sepertinya terdapat kofaktor-kofaktor yang mendorong kejadian penyakit ini. Salah satu yang menarik untuk diteliti adalah Epstein-Barr virus (EBV). Pada penelitian ini, 20 sampel swab serviks dari pasien dengan kanker serviks (positif HPV risiko tinggi), sementara 48 sampel swab serviks dari pasien dengan penyakit non-kanker serviks (negatif HPV). EBV dideteksi menggunakan uji real time PCR, sementara level DNA EBV dihitung berdasarkan persamaan Livak. Hubungan infeksi EBV sebagai kofaktor terhadap infeksi HPV dianalisis menggunakan statistik. Secara kualitatif, ditemukan bahwa populasi subyek positif EBV memiliki risiko sekitar 2,388 kali lebih mungkin menderita infeksi HPV dibandingkan populasi negatif EBV. Secara kuantitatif, jumlah DNA EBV pada populasi subyek dengan kanker serviks dan positif EBV sekitar 71 kali lebih tinggi dibandingkan dengan populasi subyek dengan kanker serviks dan negatif EBV. Secara statistik, hubungan infeksi EBV sebagai kofaktor terhadap infeksi HPV secara kualitatif maupun kuantitatif tidak bermakna (p > 0,05). Penelitian dengan populasi yang lebih besar dan multicenter dibutuhkan untuk menyokong hasil penelitian ini.

ABSTRACT
Cervical cancer is one of the most dangerous malignant diseases, with around 500,000 new cases and 240,000 deaths each year. Although its main etiology, HPV, has been associated clearly with it since the 1990s, there appears to be various cofactors driving the pathophysiology of this disease, with one of the most interesting ones being EBV. In this study, 68 cervical swab samples with known HPV DNA content is analysed for the presence of EBV DNA. 2-by-2 table analytic statistics with various methods are then conducted to understand the connections between these two pathogens and the patients disease. It is found that in this sample population, patients with HPV are around 2.388 times more likely to be infected by EBV. The amount of EBV DNA in the case population is also found to be around 71 times more than in the control population. However, both results are statistically insignificant (p > 0.05). In conclusion, the results found shows interesting proof for the complicicity of EBV in the pathophysiology of cervical cancer, although statistically insignificant. Studies with a larger population and multicentered approach are needed to support the findings of this study."
2019
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Gustina Indriati
1999
T-pdf (Tesis sedang dalam proses digitalisasi)
UI - Tesis Membership  Universitas Indonesia Library
cover
Ryan Halleyantoro
"ABSTRAK
Toksoplasmosis merupakan penyakit yang disebabkan oleh Toxoplasma gondii. Penyakit infeksi ini dapat menyebabkan kondisi fatal bila terjadi pada pasien imunokompromis, misalnya adalah toksoplasma ensefalitis (TE) yang menyerang sistem saraf pusat. Untuk menegakkan diagnosis Toxoplasma sebagai penyebab kelainan SSP (sistem saraf pusat) pada pasien HIV sangat sulit, sehingga diperlukan metode pemeriksaan lain sebagai alternatif, salah satunya adalah pemeriksaan PCR mendeteksi gen B1 dari Toxoplasma gondii. Penelitian ini bertujuan untuk mengembangkan metode PCR pada sampel CSS (cairan serebrospinal) yang sesuai untuk menegakkan diagnosis TE dan mengetahui keunggulan dan kelemahan pemeriksaan PCR dibandingkan pemeriksaan IgG anti-Toxoplasma pada cairan serebrospinal. Penelitian dilakukan pada cairan serebrospinal pasien HIV/AIDS dengan gangguan serebral. Hasil pemeriksaan PCR dari 88 sampel CSS pasien HIV yang datang ke Laboratorium Parasitologi FK UI, adalah 23 (26,1%) positif dan 65 (73,9%) negative T. gondii. Ada hubungan postif bermakna antara pemeriksaan PCR dengan pemeriksaan IgG anti-Toxoplasma dari CSS.

ABSTRACT
Toksoplasmosis is a disease caused by infection of Toxoplasma gondii. This infection can caused a life threatening condition in immunocompromised patients, for example toxoplasma ensefalitis (TE) which attack central nervous system. It is very difficult to diagnose Toxoplasma as a cause of CNS infection in HIV patient, so we need another methods as alternative, one of which is one of which is a PCR detection of Toxoplasma gondii B1 gene. This research aims to develop a PCR method on samples Cerebrospinal Fluid (CSF) that suitable for TE diagnosis and determine the advantages and disadvantages PCR methods compared to detection of anti-Toxoplasma IgG from CSF. The study was conducted in the cerebrospinal fluid of patients with HIV / AIDS with cerebral disorders. PCR examination results of 88 samples CSS HIV patients who came to the Laboratory of Parasitology FK UI, was 23 (26.1%) positive and 65 (73.9%) negative T. gondii. There is a significant positive relationship between PCR and detection anti-Toxoplasma IgG from CSF.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2016
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Lisawati Susanto
"Toxopiasnia Gondii adalah suatu protozoa yang dapat menginfeksi manusia. Infeksi T.gondii pada orang dewasa biasanva tanpa gejala klinis, sedangkan pada orang yang imunokompromais dapat berakibat fatal. Diagnosis toksoplasinosis biasanya dilakukan dengan uji serologi yaitu enzyrnelinked inunurnosorbent assay (ELISA) untuk mendeteksi IgG dan IgM Namun pemeriksaan serologi ini tidak memberikan hasil yang memuaskan, sedangkan pengobatan dini perlu dilakukan. Polymerase chain reaction (PCR) merupakan salah satu teknik yang dapat mengatasi masalah tersebut.
Penetitian bertujuan untuk mengetahui apakah teknik PCR dapat mendeteksi DNA T.gondii dengan optimasi tekniknya. Teknik ini dilakukan terhadap DNA takizoit T.gondii dengan menggunakan primer 5'GGAACTGCATCCGTTCATGAG3' dan 5'TCITTAAAGCGTTCGTGGTC3'. konsentrasi MgC12 1,5 mM dan 2,0 mM, konsentrasi enzim taq polimerase 0,7 U dan 1,75 U, konsentrasi cetakan DNA 50; 5; 1; 0,5; 0,1; 0,05; 0,01; 0,005 dan 0,001 ng dan jumlah siklus : 35 dan 55 siklus.
Hasil menunjukkan bahwa konsentrasi MgC12 1,5 mM, konsentrasi taq polimerase 1,75 U dengan jumlah siklus 55 inemberikan hasil produk PCR berupa pita berukuran 193 hp dengan konsentrasi cetakan DNA sampai 0,00 ng.
Dapat disimpulkan bahwa teknik PCR merupakan teknik yang sensitif yaitu dapat mendeteksi 1 pg DNA gondii.

Polymerase Chain Reaction to Detect Tachyzoites of Toxoplasma gondiiToxoplasma gondii is a protozoan which can infect human. T. gondii infection is oiler asymptomatic in healthy individuals, however in imrnunocompromised individuals it can be fatal. Diagnosis of toxoplasmosis is usually performed by serology using enzyme-linked immunosorbent assay (ELISA) to detect IgG and IgM. However, serology tests do not give an adequate result, while early treatment is necessarily performed. Polymerase chain reaction is a technique which can solve the problem.
The aim of this study is to know whether the PCR technique can detect ".gondii DNA. The technique was performed on DNA of T .gondii tachyzoites using Bl gene primers : 5' GGAACTGCATCCGITCATGAG3' and 5'TCTTTAAAGCGTTCGTG G T C with MgCI2 concentrations of 1.5 mM and 2.0 mM, taq polymerase concentrations of 0.7 U and 1.75U, with DNA template concentations of 50, 5, 1, 0.5. U.1, 0.05, 0.01, 0.005 and 0.001 n.. Cycles used in this study were 35 and 55.
The results showed that concentrations of 1.5 mM MgC12 and 1.75 U taq polymerase using 55 cycles gave good PCR results. With electrophoresis, the PCR product was a band of 193 bp.
It was concluded that PCR is a sensitive technique which can detect 1 pg of T .gondii DNA.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2000
LP-pdf
UI - Laporan Penelitian  Universitas Indonesia Library
cover
Nadar Sukri
"Ruang lingkup dan Cara penelitian : Toksoplasmosis adalah suatu penyakit pada manusia dan hewan yang disebabkan oleh Toxoplasma gondii. Parasit ini merupakan parasit intraselular. Pada manusia pertama kali ditemukan oleh Janku (1923). Pada wanita hamil, infeksi akut primer dapat menyebabkan kelainan bawaan, kerusakan jaringan otak janin, kematian fetus dan abortus. Penentuan terjadinya infeksi akut sangat penting karena pengobatan yang dilakukan terutama pada ibu hamil, neonatus dengan toksoplasmosis kongenital dan pasien dengan imunosupresi sangat bermanfaat dan akan mengurangi akibat infeksi. Metoda standar penentuan infeksi akut biasanya dengan pemeriksaan antibodi spesifik IgG dan IgM. IgM merupakan petanda infeksi baru sedangkan IgG petanda infeksi Iampau. Tetapi deteksi ini tidak adekuat pada pasien yang imunosupresi karena respons imun terhambat. Penelitian ini bertujuan untuk mendapatkan metoda diagnosis toksoplasmosis yang lebih sensitif dan dapat menentukan fase akut Deteksi antigen toksoplasma adalah suatu cara yang lebih sensitif dan dapat mendeteksi fase akut. Dua kelompok sampel, kelompok pertama mernpunyai IgM (+), IgG (+) dan kelompok kedua 1gM (-), IgG (+) masing-masing 30 sampel digunakan untuk deteksi antigen beredar, yang dapat digunakan sebagai penentu fase akut infeksi Toxoplasma.
Hasil dan Kesimpulan : Dari 30 sampel yang mengandung IgM (+) dan IgG (+) ada 27 (90%) antigen positif sedangkan pada kelompok IgM (-) IgG (+) diperoleh hasil 28 (93 %) antigen negatif. Dengan Uji Chi square dan koreksi Yates hasil yang antigen positif dan yang antigen negatif berbeda sangat bermakna. (X hitung = 38.4427 X tabel 0.05 = 3.841 0.01 = 6.635) (P < 0.01). Dari hasil ini dapat disimpulkan bahwa pemeriksaan antigen dapat digunakan sebagai penentu fase infeksi dan dapat dilakukan dengan cepat, sensitif dan dapat menentukan fase akut."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 1998
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>